Go to JCI Insight
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
  • Clinical Research and Public Health
  • Current issue
  • Past issues
  • By specialty
    • COVID-19
    • Cardiology
    • Gastroenterology
    • Immunology
    • Metabolism
    • Nephrology
    • Neuroscience
    • Oncology
    • Pulmonology
    • Vascular biology
    • All ...
  • Videos
    • ASCI Milestone Awards
    • Video Abstracts
    • Conversations with Giants in Medicine
  • Reviews
    • View all reviews ...
    • The cGAS-STING pathway: DNA sensing in health and disease (Jun 2026)
    • Neurodegeneration (Mar 2026)
    • Clinical innovation and scientific progress in GLP-1 medicine (Nov 2025)
    • Pancreatic Cancer (Jul 2025)
    • Complement Biology and Therapeutics (May 2025)
    • Evolving insights into MASLD and MASH pathogenesis and treatment (Apr 2025)
    • Microbiome in Health and Disease (Feb 2025)
    • View all review series ...
  • Viewpoint
  • Collections
    • In-Press Preview
    • Clinical Research and Public Health
    • Research Letters
    • Letters to the Editor
    • Editorials
    • Commentaries
    • Editor's notes
    • Reviews
    • Viewpoints
    • 100th anniversary
    • Top read articles

  • Current issue
  • Past issues
  • Specialties
  • Reviews
  • Review series
  • ASCI Milestone Awards
  • Video Abstracts
  • Conversations with Giants in Medicine
  • In-Press Preview
  • Clinical Research and Public Health
  • Research Letters
  • Letters to the Editor
  • Editorials
  • Commentaries
  • Editor's notes
  • Reviews
  • Viewpoints
  • 100th anniversary
  • Top read articles
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
Top
  • View PDF
  • Download citation information
  • Send a comment
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal
  • Top
  • Abstract
  • Introduction
  • Results
  • Discussion
  • Methods
  • Supplemental material
  • Acknowledgments
  • Footnotes
  • References
  • Version history
  • Article usage
  • Citations to this article

Advertisement

Research Article Free access | 10.1172/JCI41531

Failure to ubiquitinate c-Met leads to hyperactivation of mTOR signaling in a mouse model of autosomal dominant polycystic kidney disease

Shan Qin,1,2 Mary Taglienti,1,2 Surya M. Nauli,3 Leah Contrino,3 Ayumi Takakura,3 Jing Zhou,3 and Jordan A. Kreidberg1,2

1Department of Medicine, Children’s Hospital Boston, and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts, USA. 2Harvard Stem Cell Institute, Cambridge, Massachusetts, USA. 3Department of Medicine, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, Massachusetts, USA.

Address correspondence to: Jordan Kreidberg, Division of Nephrology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115, USA. Phone: 617.919.2959; Fax: 617.730.0129; E-mail: Jordan.Kreidberg@childrens.harvard.edu.

Find articles by Qin, S. in: PubMed | Google Scholar

1Department of Medicine, Children’s Hospital Boston, and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts, USA. 2Harvard Stem Cell Institute, Cambridge, Massachusetts, USA. 3Department of Medicine, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, Massachusetts, USA.

Address correspondence to: Jordan Kreidberg, Division of Nephrology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115, USA. Phone: 617.919.2959; Fax: 617.730.0129; E-mail: Jordan.Kreidberg@childrens.harvard.edu.

Find articles by Taglienti, M. in: PubMed | Google Scholar

1Department of Medicine, Children’s Hospital Boston, and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts, USA. 2Harvard Stem Cell Institute, Cambridge, Massachusetts, USA. 3Department of Medicine, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, Massachusetts, USA.

Address correspondence to: Jordan Kreidberg, Division of Nephrology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115, USA. Phone: 617.919.2959; Fax: 617.730.0129; E-mail: Jordan.Kreidberg@childrens.harvard.edu.

Find articles by Nauli, S. in: PubMed | Google Scholar

1Department of Medicine, Children’s Hospital Boston, and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts, USA. 2Harvard Stem Cell Institute, Cambridge, Massachusetts, USA. 3Department of Medicine, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, Massachusetts, USA.

Address correspondence to: Jordan Kreidberg, Division of Nephrology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115, USA. Phone: 617.919.2959; Fax: 617.730.0129; E-mail: Jordan.Kreidberg@childrens.harvard.edu.

Find articles by Contrino, L. in: PubMed | Google Scholar

1Department of Medicine, Children’s Hospital Boston, and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts, USA. 2Harvard Stem Cell Institute, Cambridge, Massachusetts, USA. 3Department of Medicine, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, Massachusetts, USA.

Address correspondence to: Jordan Kreidberg, Division of Nephrology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115, USA. Phone: 617.919.2959; Fax: 617.730.0129; E-mail: Jordan.Kreidberg@childrens.harvard.edu.

Find articles by Takakura, A. in: PubMed | Google Scholar

1Department of Medicine, Children’s Hospital Boston, and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts, USA. 2Harvard Stem Cell Institute, Cambridge, Massachusetts, USA. 3Department of Medicine, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, Massachusetts, USA.

Address correspondence to: Jordan Kreidberg, Division of Nephrology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115, USA. Phone: 617.919.2959; Fax: 617.730.0129; E-mail: Jordan.Kreidberg@childrens.harvard.edu.

Find articles by Zhou, J. in: PubMed | Google Scholar

1Department of Medicine, Children’s Hospital Boston, and Department of Pediatrics, Harvard Medical School, Boston, Massachusetts, USA. 2Harvard Stem Cell Institute, Cambridge, Massachusetts, USA. 3Department of Medicine, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, Massachusetts, USA.

Address correspondence to: Jordan Kreidberg, Division of Nephrology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115, USA. Phone: 617.919.2959; Fax: 617.730.0129; E-mail: Jordan.Kreidberg@childrens.harvard.edu.

Find articles by Kreidberg, J. in: PubMed | Google Scholar

Published September 13, 2010 - More info

Published in Volume 120, Issue 10 on October 1, 2010
J Clin Invest. 2010;120(10):3617–3628. https://doi.org/10.1172/JCI41531.
© 2010 The American Society for Clinical Investigation
Published September 13, 2010 - Version history
Received: October 21, 2009; Accepted: July 28, 2010
View PDF
Abstract

Autosomal dominant polycystic kidney disease (ADPKD) is a common inherited disorder that is caused by mutations at two loci, polycystin 1 (PKD1) and polycystin 2 (PKD2). It is characterized by the formation of multiple cysts in the kidneys that can lead to chronic renal failure. Previous studies have suggested a role for hyperactivation of mammalian target of rapamycin (mTOR) in cystogenesis, but the etiology of mTOR hyperactivation has not been fully elucidated. In this report we have shown that mTOR is hyperactivated in Pkd1-null mouse cells due to failure of the HGF receptor c-Met to be properly ubiquitinated and subsequently degraded after stimulation by HGF. In Pkd1-null cells, Casitas B-lineage lymphoma (c-Cbl), an E3-ubiquitin ligase for c-Met, was sequestered in the Golgi apparatus with α3β1 integrin, resulting in the inability to ubiquitinate c-Met. Treatment of mouse Pkd1-null cystic kidneys in organ culture with a c-Met pharmacological inhibitor resulted in inhibition of mTOR activity and blocked cystogenesis in this mouse model of ADPKD. We therefore suggest that blockade of c-Met is a potential novel therapeutic approach to the treatment of ADPKD.

Introduction

Polycystic kidney disease (PKD) is one of the most common inherited disorders that result in severe and debilitating disease. There are two predisposing loci, PKD1 and PKD2, residing on chromosomes 16 and 4, respectively (1, 2), which encode polycystin-1 and polycystin-2. Extensive study of polycystins and associated proteins has begun to elucidate the molecular biology of cystogenesis (3). Nevertheless, the precise molecular mechanisms of cyst formation remain to be determined.

Several primary pathogenetic mechanisms have been considered to be responsible for cyst formation, including: (a) abnormal regulation of epithelial cell proliferation (4–6); (b) abnormal transepithelial transport resulting in fluid accumulation in tubular lumina (7, 8); and (c) remodeling of the ECM, leading to abnormal epithelial morphology, proliferation, and/or survival (9–11). Several signal transduction pathways are known to regulate epithelial cell expansion during kidney development, including those downstream of c-Ret (12) and of receptors for FGFs (13, 14) and bone morphogenetic proteins (BMPs) (13). An additional receptor tyrosine kinase, c-Met, is expressed in collecting duct epithelial cells and binds HGF. A role for c-Met in branching morphogenesis within the developing kidney has long been suggested because of the ability of HGF to stimulate the formation of branched tubules by MDCK cells in 3D collagen gels (15, 16). A role for HGF and c-Met in cystic kidney disease has also been suggested by observations that both HGF and c-Met are overexpressed by cyst-lining cells in kidneys from individuals with PKD or acquired cystic disease (6, 17).

Integrin receptors are heterodimeric transmembrane proteins that mediate attachment of cells to the ECM. We previously demonstrated a role for α3β1 integrin in kidney development; targeted mutation of the α3 integrin gene results in shorter and fewer collecting ducts in mutant kidneys, an observation consistent with decreased branching morphogenesis and/or decreased epithelial tubule expansion (18). Small cysts are also observed in α3 integrin mutant kidneys, suggesting that α3β1 integrin may have a role in maintaining normal tubular morphology and dysfunction of α3β1 integrin may relate to cystogenesis. Consistent with this finding, a hypomorphic mutation in the mouse laminin α5 gene, which encodes the major ligand for α3β1 integrin, causes a phenotype that resembles PKD (19). A major signaling pathway through which integrins regulate epithelial cell behavior involves PI3K and Akt (20, 21). Mammalian target of rapamycin (mTOR) is one of the major targets of Akt, and increased activation of mTOR has been suggested to contribute to cyst formation in mice and humans (22). How mTOR activity is controlled in PKD is not fully understood.

Here we show that glycosylation of the α3 integrin subunit is defective and α3β1 integrin is retained in the Golgi apparatus in Pkd1–/– cells. Casitas B-lineage lymphoma (c-Cbl), an E3 ubiquitin ligase normally responsible for ubiquitination of c-Met, is also sequestered in the Golgi apparatus with α3β1 integrin in Pkd1–/– cells. Consistent with these results, ubiquitination of c-Met after stimulation with HGF is defective in Pkd1–/– cells, and there is an increased c-Met–dependent activation of the PI3K/Akt/mTOR signaling pathway. Additionally, pharmacological blockade of c-Met signaling results in a dramatic decrease in cyst formation in Pkd1–/– embryos.

Results

Hyperactivation of mTOR in Pkd1–/– cells is dependent on c-Met. Consistent with previously published results (22), mTOR and S6K were hyperphosphorylated in an immortalized Pkd1–/– cell line derived from E15.5 Pkd1–/– kidneys (ref. 23 and Figure 1). Stimulation with HGF accentuated the difference in mTOR and S6K phosphorylation between Pkd1–/– and WT (Pkd1+/+) cells, whereas treatment with a c-Met inhibitor (Met Kinase Inhibitor, Calbiochem) reduced mTOR phosphorylation in Pkd1–/– cells to a baseline level observed in WT cells (Figure 1, A–D). HGF-dependent phosphorylation of Akt was also stronger in Pkd1–/– cells than in Pkd1+/+ cells (Figure 1, E and F). These results indicate that hyperactivation of mTOR in PKD may occur downstream of the receptor tyrosine kinase c-Met, and through the c-Met/Akt pathway.

HGF stimulation causes hyper-phosphorylation of mTOR (A and B), S6K (C andFigure 1

HGF stimulation causes hyper-phosphorylation of mTOR (A and B), S6K (C and D), and Akt (E and F) in Pkd1–/– cells. Western blots for phospho-mTOR and mTOR (A), phospho-S6K (Thr398) and S6K (C), phospho-Akt (Ser473) and Akt (E). Densitometry is shown in B, D, and F, and values for each lane are shown below each blot. In all experiments, serum-starved Pkd1+/+ and Pkd1–/– cells were incubated with media alone (control) or media containing HGF (50 ng/ml for 20 minutes). In A and B, c-Met inhibitor (5 mM for 40 minutes) was also included. (A and B) mTOR is hyperphosphorylated in Pkd1–/– cells, both at steady state and after HGF stimulation; steady-state phosphorylation is sensitive to c-Met inhibitor. (C and D) S6K (Thr398) is hyperphosphorylated in Pkd1–/– cells after stimulation with HGF. (E and F) Akt is hyperphosphorylated in Pkd1–/– cells after stimulation with HGF. All figures are representative of 3 experiments.

Defective ubiquitination of c-Met in Pkd1–/– cells. To elucidate the mechanism whereby HGF stimulation resulted in hyperphosphorylation of mTOR in Pkd1–/– cells, we first examined levels of c-Met, Akt, and mTOR in immortalized Pkd1–/– and WT cells. Akt and mTOR were present at equivalent levels (Figure 1, A, B, E, and F), whereas c-Met was more abundant in Pkd1–/– cells (Figure 2B). Higher levels of c-Met and phospho–c-Met were also observed in murine Pkd1–/– E17.5 kidneys (Figure 2A). Increased expression of c-Met protein was confirmed in a second set of experiments in which Pkd1 expression was knocked down in WT cells (KD4 cells [Supplemental Figure 1]; identical results were obtained with KD1 cells [data not shown]; supplemental material available online with this article; doi: 10.1172/JCI41531DS1) (Figure 2D). c-Met protein levels were also elevated in protein extracts of human PKD kidneys (Figure 2C). Increased protein levels of c-Met could reflect either increased synthesis or defective degradation of the protein. No difference in c-Met mRNA levels was observed between Pkd1+/+ and Pkd1–/– or Pkd1-knockdown cells (Figure 2, E and F). Translational control of c-Met expression has not yet been examined. However, a marked difference in post-stimulatory degradation of c-Met was observed: 30 minutes after HGF stimulation of serum-starved cells, the level of c-Met was reduced 6-fold in Pkd1+/+ cells, but negligibly reduced in Pkd1–/– or Pkd1-knockdown cells (KD4) relative to the prestimulatory level of c-Met in each cell type (Figure 2, B and D). Finally, surface labeling of cells with membrane-impermeable biotin confirmed that most c-Met was localized to the plasma membrane in Pkd1+/+ and Pkd1–/– or Pkd1-knockdown cells (Figure 3, A and B).

Increased expression and impaired degradation of c-Met in Pkd1–/– cells.Figure 2

Increased expression and impaired degradation of c-Met in Pkd1–/– cells. (A) Western blot for phospho–c-Met (Tyr1234/1235) and c-Met in Pkd1+/+ and Pkd1–/– E17.5 kidneys. Quantification is shown on the right. (B) Western blot of c-Met in Pkd1+/+, Pkd1–/–, Itga3+/+, and Itga3–/– cells, with or without HGF stimulation (50 ng/ml HGF for 30 minutes). Densitometric quantification is shown on the right. c-Met was more abundant before stimulation and failed to be degraded in Pkd1–/– cells. Degradation was also reduced in Itga3–/– cells. GAPDH is shown as a loading control. (C) Western blot of c-Met in extract of human non-cystic and PKD kidneys. Higher levels of c-Met and an additional higher-molecular-weight species are present in the PKD sample. Densitometric quantification is shown on right, each bar represents the average of the 3 samples on left. (D) Western blot for c-Met after shRNA knockdown of Pkd1 (KD4 cells), also showing increased levels of c-Met in nonstimulated cells and decreased degradation. (E and F) Reverse transcription quantitative PCR (RT-qPCR) for c-Met in Pkd1+/+ and Pkd1–/– cells (E), or Pkd1+/+ cells and KD4 cells (F). In E and F, the level of c-Met mRNA in Pkd1–/– cells is shown relative to the amount in Pkd1+/+ or Ctrl cells. 18S RNA was used as an input control (D) and for normalization of RT-qPCR (E and F).

c-Met is localized at the plasma membrane in WT, Pkd1–/–, and Pkd1-knockdowFigure 3

c-Met is localized at the plasma membrane in WT, Pkd1–/–, and Pkd1-knockdown cells. Cells were labeled with membrane-impermeable sulfo-NHS-biotin; after extraction, labeled proteins were pulled down by avidin beads. Residual c-Met, representing unlabeled protein, was detected by c-Met immunoprecipitation. (A and B) Most c-Met is localized at the plasma membrane in WT, Pkd1–/–, and KD4 cells. Little c-Met is detected in the post-immunoprecipitation fraction (after IP). (C and D) Failure to ubiquitinate c-Met in Pkd1–/– or KD4 cells. Pkd1–/– and Pkd1+/+ cells (C) or KD4 and control cells (D) were stimulated with HGF, and cell lysates were immunoprecipitated with c-Met antibody and blotted with anti-ubiquitin. Nonstimulated cells showed little ubiquitination of c-Met. The immunoprecipitation was validated by a re-blot for c-Met (lower panels). (E) c-Cbl phosphorylation after HGF stimulation is decreased in Pkd1–/– cells. Control and mutant cells were incubated with HGF (50 ng/ml, 10 minutes). Phospho–c-Cbl and total c-Cbl were detected by Western blot. c-Cbl phosphorylation after HGF stimulation is weaker in both Pkd1–/– and Itga3–/– cells, compared with their WT controls. (F) c-Cbl binds α3β1 integrin in both Pkd1+/+ and Pkd1–/– cells. Pairs of lanes are designated as starting lysate, anti–α3 integrin or non-immune IgG control immunoprecipitated material, and residual non-immunoprecipitated material. The membrane was reblotted with anti–α3 integrin antibody to validate the immunoprecipitation. c-Cbl partially coimmunoprecipitated with α3β1 integrin in Pkd1+/+ and completely in Pkd1–/– cells. (G) α3β1 integrin and c-Cbl are not localized to the membrane in Pkd1–/– cells. Cells were labeled with sulfo-NHS-biotin, labeled proteins were pulled down with avidin-coupled beads, and nonlabeled protein immunoprecipitated with anti–α3 integrin. Western blots for α3 integrin (upper panel) and c-Cbl (lower panel). In Pkd1–/– cells, little α3β1 integrin or c-Cbl is localized at the plasma membrane.

Degradation of c-Met occurs through two distinct pathways. One pathway is ligand-dependent through ubiquitination; the other is ligand-independent through shedding of an extracellular domain (24, 25). Because difference in c-Met observed in our study reflected a post-stimulatory situation, we examined ubiquitination of c-Met. Abundant ubiquitination of c-Met after HGF stimulation was apparent in Pkd1+/+ cells but virtually undetectable in Pkd1–/– cells (Figure 3C) or knockdown cells (Figure 3D). Addition of a proteasomal inhibitor (lactacystin) served to further demonstrate the failure to ubiquitinate c-Met in Pkd1–/– cells (Supplemental Figure 2). Ubiquitination of c-Met requires association of the c-Met cytoplasmic domain with c-Cbl, a c-Met E3 ubiquitin ligase, and subsequent phosphorylation of c-Cbl. Phosphorylation of c-Cbl after HGF stimulation was decreased in Pkd1–/– cells compared with Pkd1+/+ cells (Figure 3E). Thus, the absence of polycystin-1 appeared to dramatically affect ubiquitination of c-Met through c-Cbl. c-Cbl is involved in the ubiquitination of other receptor tyrosine kinases, and similar deficient degradation was observed for EGFR and PDGFR-β (Supplemental Figure 3).

Sequestration of α3β1 integrin and c-Cbl in the Golgi apparatus in Pkd1–/– cells. α3β1 integrin is highly expressed by Pkd1+/+ and Pkd1–/– cells. As c-Cbl is known to interact with integrins (26), the role of α3β1 integrin in c-Cbl phosphorylation and localization was examined. Co-immunoprecipitation demonstrated abundant association of c-Cbl with α3β1 integrin in Pkd1+/+ cells; this association become nearly complete in Pkd1–/– cells, as little c-Cbl was found in residual extracts after immunodepletion with α3 integrin antibody (Figure 3F). Additionally, biotinylation of cell surface proteins followed by affinity purification with immobilized NeutrAvidin protein beads confirmed the decreased membrane localization of α3β1 integrin and c-Cbl in Pkd1–/– cells (Figure 3G). Furthermore, while costaining of α3β1 integrin and c-Cbl in Pkd1+/+ cells demonstrated membrane colocalization along cell-cell junctions (Figure 4A), both α3β1 integrin and c-Cbl acquired a predominantly cytoplasmic localization in Pkd1–/– or Pkd1-knockdown KD4 cells (Figure 4, A and B). The appearance of α3β1 integrin and c-Cbl staining was suggestive of localization within the Golgi apparatus; this was confirmed by costaining with the Golgi marker GM130, which only overlapped with c-Cbl and α3β1 integrin in Pkd1–/– cells (Figure 4, C and D), but not in Pkd1+/+ cells. To determine whether α3β1 integrin was indeed required for the sequestration of c-Cbl in Pkd1–/– cells, we knocked down Pkd1 in Itga3–/– cells (KD8 cells, Supplemental Figure 1). In the absence of α3β1 integrin, c-Cbl was no longer sequestered in the Golgi in Pkd1-knockdown cells and was able to localize to the plasma membrane, as demonstrated by costaining with the junctional protein ZO-1 (Figure 4, E and F). When discontinuous sucrose gradient separation was used to enrich a Golgi apparatus fraction, α3β1 integrin and c-Cbl were found in the Golgi apparatus-enriched fraction of Pkd1–/– cells but not Pkd1+/+ cells (Figure 4G).

α3 integrin and GM130 localization in Pkd1+/+ and Pkd1–/– cells.Figure 4

α3 integrin and GM130 localization in Pkd1+/+ and Pkd1–/– cells. (A and B) Colocalization of c-Cbl and α3β1 integrin. Both c-Cbl and α3β integrin are present in at cell-cell junctions in Pkd1+/+ cells. In Pkd1–/– cells (A) or Pkd1-knockdown cells (KD4) (B), c-Cbl is concentrated in the perinuclear area, and α3β1 integrin both is present at cell-cell junctions and colocalizes with c-Cbl in a perinuclear pattern. (C) c-Cbl and (D) α3β1 integrin colocalize (yellow staining) with GM130, a Golgi marker, in Pkd1–/– but not Pkd1+/+ cells. (E) In Itga3–/–Pkd1-knockdown (KD8) cells, c-Cbl is localized at the plasma membrane, as demonstrated by overlapping staining with ZO-1. (F) c-Cbl does not colocalize with GM130 in KD8 cells. Scale bars: 20 μm. (G) Discontinuous sucrose gradient enrichment of the Golgi apparatus from Pkd1+/+ and Pkd1–/– cells. Both α3β1 integrin and c-Cbl are present in the Golgi-enriched fraction from Pkd1–/– cells, but neither was detected in the Golgi-enriched fraction from Pkd1+/+ cells. The Western blot of GM130 in the lower panel validates the Golgi enrichment.

We have recently demonstrated (27) that α3β1 integrin is required for c-Met to be activated following stimulation by HGF, raising the question of how activation of c-Met may be involved in cystogenesis if α3β1 integrin is sequestered in the Golgi. However, a small fraction of α3 integrin remained localized in the plasma membrane in Pkd1–/– cells (Figure 4A) and, more obviously, in Pkd1-knockdown cells (Figure 4B), which may have accounted for the ability of c-Met to be activated in Pkd1–/– cells. Moreover, in contrast to the abnormal localization of α3β1 integrin and c-Cbl, surface labeling with membrane-impermeable biotin reagent demonstrated that c-Met was mainly localized to the cell membrane in WT, Pkd1–/–, and Pkd1-knockdown (KD4) cells (Figure 3, A and B).

The association of c-Cbl with α3β1 integrin prompted us to examine a possible requirement for α3β1 integrin in the c-Cbl–mediated degradation of c-Met. Equivalent amounts of c-Met (Figure 2B) and c-Cbl (Figure 3E) were present in Itga3+/+ and Itga3–/– cells (28). Furthermore, c-Cbl was localized at the plasma membrane in Itga3–/– cells (Supplemental Figure 3). However, c-Cbl phosphorylation after HGF stimulation was decreased in Itga3–/– cells (Figure 3E), and as in Pkd1–/– cells after HGF stimulation, c-Met was incompletely degraded in Itga3–/– cells (Figure 2B). Thus, α3β1 integrin has a role, though not absolute, in obtaining maximal degradation of c-Met. Most likely, this relates to the requirement for α3β1 integrin to maximally activate c-Met– and c-Cbl–mediated degradation.

Together, these results suggest that the abnormal accumulation of c-Met in Pkd1–/– cells may result from the decreased activation of c-Cbl and deficient ubiquitination of c-Met. The resultant effect of this abnormal handling of c-Met appears to be the hyperactivation of mTOR.

Glycosylation of α3β1 integrin subunit is defective in Pkd1–/– cells. The finding that α3β1 integrin and c-Cbl were mislocalized in the Golgi in Pkd1–/– cells was reminiscent of findings that E-cadherin was also improperly processed in the Golgi apparatus in Pkd1 mutant cells (29). Since the modification of protein glycosylation is a major event occurring in the late endoplasmic reticulum and Golgi, the glycosylation of the α3 subunit was examined. We observed that the α3 integrin subunit displayed abnormal mobility in SDS-PAGE electrophoresis (Figure 5A). Moreover, treatment of the cell lysate with alkaline phosphatase did not eliminate this difference in mobility (data not shown), which argues against the possibility of differential protein phosphorylation between Pkd1+/+ and Pkd1–/– cells. In contrast, treatment with PNGase F eliminated the difference in mobility (Figure 5A), and comparison of the migration after treatment with PNGase F versus Endo H indicated that a greater proportion of the α3 subunit was processed to an Endo H–resistant form, while a greater proportion retained greater Endo H sensitivity in Pkd1–/– cells. These results are more consistent with defects in glycosylation occurring in the late endoplasmic reticulum or Golgi apparatus that are responsible for removing the high mannose structure and conferring complex glycosylation patterns on glycoproteins. A similar change in migration of the α3 integrin subunit in electrophoresis was also observed in an extract of a kidney from a human individual with PKD (Figure 5B).

Defective glycosylation of α3 integrin.Figure 5

Defective glycosylation of α3 integrin. (A) Defective glycosylation of α3 integrin subunit in Pkd1–/– cells. Western blot using an α3 integrin antibody. Treatment with Endo H or PNGase is designated above the lanes; the first two lanes are untreated. PNGase removes all N-linked glycosylation, whereas Endo H removes only high mannose glycosylation. α3 Integrin subunit shows a faster migration in Pkd1–/– cells than Pkd1+/+ cells. Digestion with deglycosylating enzymes eliminates this difference. (B) Western blot of α3 integrin in samples of human PKD and non-cystic kidneys. Faster migration is observed in the sample from a PKD kidney. The GAPDH loading control for this blot is that shown in Figure 2C. A is from a reducing gel blotted with α3 integrin C-terminal antibody, and B is from a nonreducing gel blotted with α3 integrin N-terminal antibody.

Altered distribution of c-Cbl and α3β1 integrin in vivo in Pkd1–/– kidneys. To confirm that our findings with immortalized cell lines were relevant to changes that occurred in vivo, we compared the localization of α3β1 integrin and c-Cbl in epithelial cells of Pkd1+/+ and Pkd1–/– kidneys. As predicted, both α3β1 integrin and c-Cbl showed a basolateral distribution in tubules of WT kidneys (Figure 6, A and B). In contrast, and reflecting the in vitro observations, in epithelial cells lining the cysts of Pkd1–/– kidneys, both c-Cbl and α3β1 integrin localized in a perinuclear distribution (Figure 6, A and B). Similar findings were obtained using specimens from a PKD human individual (Figure 6C). These in vivo data confirmed that c-Cbl and α3β1 integrin are sequestered in the cytoplasm of epithelial cells and cannot be correctly targeted to the plasma membrane.

Inhibition of Akt and S6K activity in vivo by c-Met inhibitor.Figure 6

Inhibition of Akt and S6K activity in vivo by c-Met inhibitor. Differential localization in vivo for α3β1 integrin and c-Cbl in WT and Pkd1–/– mouse kidneys. (A) Costaining for α3 integrin and c-Cbl. (B) Costaining for β1 integrin and c-Cbl. In each panel, the genotype is noted in the upper-left corner, and the stain is noted above. The third panel in each row shows an overlay, with a magnified image (×600) in the fourth panel. α3β1 integrin is present in a basolateral distribution in WT and a cytoplasmic distribution in the Pkd1–/– tubules. c-Cbl has a basal distribution in WT and cytoplasmic localization that overlaps with α3β1 integrin in Pkd1–/– tubules. (C) Staining for c-Cbl and α3β1 integrin in human non-cystic and PKD kidneys, showing basolateral localization of c-Cbl and α3β1 integrin in the non-PKD sample and perinuclear pattern in the PKD sample. Scale bars: 50 μm.

Treatment of Pkd1–/– cystic kidneys in organ culture with c-Met inhibitor can decrease the size and number of kidney cysts. These observations predict that blockade of signaling by c-Met would reduce cyst formation in Pkd1–/– kidneys. As a first test of this hypothesis, embryonic organ cultures from WT and Pkd1–/– kidneys were treated with a pharmacological blocker of c-Met (Su11274, Calbiochem, used at 5 μM). Typically, kidneys placed in organ culture, even from Pkd1–/– mice, do not develop or maintain cysts unless treated with 8-Br-cAMP (30), a membrane-permeable cAMP analog that is more resistant to phosphodiesterase cleavage than cAMP and that preferentially activates cAMP-dependent protein kinase (PKA) (31, 32). An appropriate concentration of 8-Br-cAMP was titrated to promote prominent cyst formation in Pkd1–/– kidneys but little in WT kidneys. Treatment with the c-Met inhibitor reduced cyst formation in organ culture in Pkd1–/– mutant kidneys to the minimal level observed in WT kidneys (Figure 7A). Similar results were obtained with a second c-Met inhibitor (PHA665752, Tocris, used at 0.5 μM) or a c-Met blocking antibody (R&D Systems, used at 5 μg/ml) (data not shown). Importantly, the c-Met inhibitor did not have a marked effect on nephrogenesis in either WT or mutant kidneys (Supplemental Figure 2).

A c-Met inhibitor decreased the size and number of cysts in Pkd1–/– kidneysFigure 7

A c-Met inhibitor decreased the size and number of cysts in Pkd1–/– kidneys. (A) Treatment in an organ culture model of PKD. The genotype and treatment are noted on the left and above the panels, respectively. Pkd1+/+ and Pkd1–/– mice kidneys at E15.5 were removed from embryonic mice and put in organ culture dishes, containing media with 10 μM 8-Br-cAMP. Twelve hours later, either 5 μM c-Met inhibitor Su11274 (dissolved in DMSO) or the same amount of DMSO was added to the media. Hematoxylin and eosin–stained sections of kidneys are shown after 96 hours of treatment. Scale bars: 200 μm. (B) Treatment of pregnant mice with c-Met inhibitor. Pkd1+/– pregnant mice that had been mated with Pkd1+/– male mice were treated twice daily between E14 and E17 with vehicle only (top row) or c-Met inhibitor (bottom row). c-Met inhibitor treatment can decrease cyst formation in Pkd1–/– embryonic kidneys. A high-power view is shown at right. (C) Kidney development in utero in WT kidneys was not affected by treatment with c-Met inhibitor. Top panels: WT kidney from vehicle-only treatment; bottom panels: WT kidney from c-Met inhibitor–treated litter. Scale bars in B and C: 200 μm (left), 50 μm (right). (D) Quantitative analysis of cystic area in Pkd1–/– embryonic kidneys treated with vehicle or c-Met inhibitor. Kidneys from 9 pairs of vehicle and c-Met inhibitor–treated mice were quantified by NIS-Elements BR. The difference in cyst area between vehicle- and c-Met inhibitor–treated group is significant (*P = 0.003), as analyzed by paired Student’s t test.

Based on the results with organ cultures, the c-Met inhibitor was then used to treat pregnant mice carrying litters that included Pkd1–/– embryos, which normally develop dramatic cysts by E18. Pregnant females were treated twice daily between E14 and E17, and embryonic kidneys were examined at E18.5. There was a marked reduction in cyst numbers and size in kidneys of Pkd1–/– embryos in treated versus control litters (the total cyst area reduced from approximately 47% to 19%, P = 0.003) (Figure 7, B and D). Examination of WT kidneys from treated litters revealed no adverse effects on nephrogenesis (Figure 7C). To elucidate whether c-Met inhibitor treatment can inhibit Akt/mTOR signaling in our system, we examined phosphorylation status of Akt and S6K, one of the mTOR substrates, after treatment with c-Met inhibitor or vehicle. Compared with vehicle, the c-Met inhibitor decreased activation of Akt and S6K (Figure 8).

Inhibition of Akt and S6K activity in vivo by c-Met inhibitor.Figure 8

Inhibition of Akt and S6K activity in vivo by c-Met inhibitor. Immunohistochemical staining (A) and Western blot analysis (B) of phospho-Akt and phospho-S6K in vehicle- and c-Met inhibitor–treated embryonic kidneys. Genotypes are indicated at left and treatment above each column. Each inset in A shows a higher-power view (×600). c-Met inhibitor treatment decreases staining of phosphorylated Akt and phosphorylated S6K in Pkd1–/– embryonic kidneys. Scale bars: 50 μm. (B) Western blot for phospho-Akt and phospho-S6K in kidneys of c-Met inhibitor–treated and untreated embryos. Re-blots for total Akt and total S6K are shown below the anti–phospho-protein blots. (C) Quantification of phospho-Akt staining. (D) Quantification of phospho-S6K staining.

Discussion

Despite the significant morbidity associated with autosomal dominant PKD (ADPKD), there are no approved treatments specifically targeted toward molecular pathways that are aberrantly regulated in this relatively common hereditary disease. Here we suggest that c-Met might be a therapeutic target in PKD. In the present study, we have shown that in Pkd1–/– cells, there is a hyperactivation of c-Met signaling, due to a failure to ubiquitinate c-Met following stimulation with HGF. A role for HGF signaling in cystic disease was suggested by previous studies in which transgenic mice overexpressing HGF developed prominent tubular cysts in their kidneys (33) and elevated levels of HGF have been detected in cyst fluid from PKD patients (6). Normally, activation of c-Met leads to recruitment and phosphorylation of c-Cbl, an E3 ubiquitin ligase for c-Met. Defective ubiquitination of c-Met in Pkd1–/– cells appears to be due to sequestration of c-Cbl in the Golgi apparatus by α3β1 integrin. Hyperactivated c-Met signaling results in increased mTOR activity in Pkd1–/– cells. As a validation of the role of c-Met in the formation of cysts in ADPKD, a c-Met inhibitor was shown to inhibit cyst formation in an ex vivo organ culture model of ADPKD, and also in embryonic Pkd1–/– kidneys through inhibition of Akt and S6K phosphorylation. These findings suggest that hyperactivated c-Met signaling may be causative for mTOR activation and c-Met inhibitors may represent a new strategy to treat PKD.

c-Met and hyperactivation of mTOR. Epithelial cells lining cysts of ADPKD kidneys exhibit high mTOR activity (22). Rapamycin, an mTOR inhibitor, has been shown to be effective in alleviating the cystic phenotype in the Tg737orpk/orpk mouse model for PKD (22). Furthermore, in individuals with PKD, rapamycin treatment for immunosuppression after kidney transplantation reduces the volume of cysts in the recipients’ native kidneys (22). One hypothesized role of mTOR in PKD relates to its negative regulation by tuberin, the product of the TSC2 gene, known to be mutated in tuberous sclerosis. Tuberin is itself negatively regulated by PI3K/Akt. Polycystin-1, the product of the Pkd1 gene, is also known to associate with tuberin, providing a possible mechanistic link between the loss of polycystin-1 expression and hyperactivation of mTOR. Our results provide an additional mechanistic explanation for the hyperactivation of mTOR, suggesting that it occurs downstream of c-Met. The two major processes thought to contribute to cystogenesis are increased proliferation and fluid secretion (34–36). A role for proliferation in PKD is supported by findings of increased BrdU incorporation (37), Ki-67 staining (38), and PCNA staining (39) in cyst-lining cells. Hyperactivation of c-Met would likely lead to increased proliferation (40, 41), consistent with these findings. On the other hand, Piontek et al. failed to find an increase in proliferation, and thus, the role of proliferation in PKD remains controversial (42). Whether signaling through c-Met could affect fluid secretion and other cell behaviors that might convert epithelial cells to a cystic phenotype remains to be determined.

Golgi defects in PKD. Our proposed mechanism for mTOR overactivation — that is, defective ubiquitination of c-Met secondary to sequestration of c-Cbl in the Golgi — raises the question of why the absence of polycystin-1 may affect protein modification and transport within the Golgi apparatus. Other reports have also identified abnormal Golgi function in PKD, including abnormal proteoglycan synthesis and altered intracellular transport of proteoglycan in ADPKD (43–46). Impaired basolateral trafficking of proteins and lipids, including E-cadherin and C6-NBD-ceramide, has been reported in ADPKD cells as a result of defective cargo exit from the Golgi (29, 47). Impaired trafficking of sulfated glycoproteins has also been reported in ADPKD (48). The aberrant glycosylation of the α3 integrin subunit may represent a primary defect leading to abnormal transport through the Golgi apparatus or may be secondary to another defect in protein transport. However, since c-Cbl is not a glycosylated protein, it is unlikely that a transport defect relating to glycosylation would affect c-Cbl similarly to glycosylated proteins such as α3β1 integrin or E-cadherin. Additionally, the Golgi apparatus were flattened and deformed in Pkd1–/– cells, which serves as an additional indication of a major Golgi defect in PKD (47). Finally, a recent report showed that in polycystin-2–depleted Schizosaccharomyces pombe, plasma membrane proteins are also trapped in the Golgi apparatus (49). Together, these observations suggest a major, though not complete, defect of protein processing in the Golgi and protein trafficking in ADPKD. Defective trafficking in PKD may relate to mislocalization of Rab proteins; for example, Rab8 was previously shown to be mislocalized from the Golgi in ADPKD cells (47).

Receptor tyrosine kinases signaling in PKD. The c-Met inhibitor was able to effectively block activation of mTOR in Pkd1–/– cells. However, we also demonstrated deficient degradation of other receptor tyrosine kinases, including EGFR and PDGRFβ. This raises the question of whether c-Met is the only receptor tyrosine kinase involved in cyst formation. This is an important question, because if cyst formation results from increased expression of multiple receptor tyrosine kinases, this provides an avenue for combination therapies that involve subtoxic doses of multiple agents, rather than higher doses of a single agent, to prevent cyst formation in individuals with PKD. It is well established that there is considerable crosstalk between different receptor tyrosine kinases; this is especially well studied for c-Met and EGFR (50). Thus, it is possible that addition of the c-Met inhibitor, while primarily affecting c-Met, may also indirectly affect activation of EGFR and other receptor tyrosine kinases.

c-Met and epithelial morphogenesis. c-Met has received intense study for its role in epithelial morphogenesis. The ability of HGF to induce the formation of branched tubules in 3D collagen gels has suggested a role for c-Met signaling in branching morphogenesis. A potential model for branch formation suggests that branches are initiated when epithelial cells fail to restrict the orientation of cell division to a 2D monolayer or to the long axis of a simple tubule and instead orient the axis of cell division such that cells emerge from the tubule to initiate a branching event. The regulatory events that govern the orientation of cell division are thought to be a manifestation of planar cell polarity (PCP), a term used to describe how cell behavior is regulated by cellular interactions between lateral membranes (as opposed, for instance, to processes that regulate apical-basal polarity) to govern cell behavior within a plane. One major way in which PCP-related processes may regulate cell behavior is by regulating the orientation of mitotic spindles during cell division. Whether abnormal regulation of PCP has a role in cyst disease is presently undergoing important consideration (51). There are now several examples of randomized or inappropriate mitotic spindle orientation in various models of PKD, including the PCK rat model of cystic disease (52), FAT4 mutant mice (53), and Kif3a conditional mutant mice (54).

A possible role for c-Met in regulating PCP is suggested by several observations. First, signaling downstream of c-Met, as with other receptor tyrosine kinases, has the capacity to disrupt cell-cell interactions, in part by causing increased tyrosine phosphorylation of β-catenin (55) and consequent disruption of cadherin-mediated cell-cell adhesion, facilitating the exit of cells from a monolayer or the initiation of a branch point. Second, it has been observed that HGF stimulation can result in increased variation in mitotic spindle orientation (56) that would also facilitate the initiation of a branch point in a simple tubule. Taken together, these observations suggested an association between aberrant HGF/c-Met signaling and cystogenesis in the kidney. How might these normal functions of c-Met in epithelial morphogenesis be co-opted to result in cyst formation in PKD? Hyperactivation of c-Met may contribute to excessive randomization of mitotic spindle orientation, as has been shown to occur in cystic disease (52), replacing branching events with the initiation of cysts. It may also contribute by excessive disruption of cadherin mediate cell-cell adhesion, contributing to the abnormal morphology of cyst-lining cells that are highly flattened along the basement membrane, with minimal lateral junctions.

Golgi function and cilia in PKD. Cilia are the present focal point of research on PKD (57). Polycystins-1 and -2 and many other proteins involved in cystogenesis are localized to the cilia, among other subcellular compartments (58). Several recent observations have begun to draw physical links between the cilia and the Golgi apparatus (47, 59). For example, several proteins including IFT20, dyenin2, and kinesin-2 are found in both the Golgi apparatus and cilia (60). It is suggested that IFT20 functions in the delivery of ciliary membrane proteins from Golgi complex to the cilium. Furthermore, there may be structural continuity between Golgi and the centrosome as well as basal body of the primary cilia (61, 62). These observations suggest that a primary Golgi defect may lead to cilia malfunction and cyst formation in PKD.

On the other hand, it is more difficult to formulate hypotheses about how a primary cilia defect might cause abnormal protein processing in the Golgi. One possibility is that this is very indirect and results from abnormal regulation of gene expression by signals transduced from the cilia. For example, the cilia is a major locus of sonic hedgehog signaling, and the abnormal ratios of Gli activator to repressor isoforms that might be expected to result from ciliary dysfunction could be predicted to have important effects on gene expression, including of genes that encode proteins involved in protein trafficking, as this constitutes a large group of proteins within the cell.

Methods

Reagents. Antibodies included rabbit polyclonal anti–mouse α3 integrin (custom prepared by Invitrogen), goat polyclonal α3 integrin (Santa Cruz Biotechnology Inc. N-19), rabbit polyclonal anti–mouse mTOR, and anti–mouse phospho-mTOR (Cell Signaling Technology 2972 and 2971), mouse monoclonal anti–mouse c-Met (Cell Signaling Technology 3127), c-Met blocking antibody (R&D Systems AF527), mouse monoclonal anti–mouse ubiquitin (Cell Signaling Technology 3936), rabbit polyclonal anti–mouse c-Cbl (Santa Cruz Biotechnology Inc. sc-170), mouse monoclonal anti–mouse GM130 (BD 610822). c-Met inhibitor Su11274 was purchased from Calbiochem and PHA665752 from Tocris. EZ-Link Sulfo-NHS-Biotin was purchased from Thermo Fisher Scientific (catalog 21217). Hepatocyte growth factor was obtained from Sigma-Aldrich (catalog H1404). Unless otherwise stated, all other chemicals were purchased from Sigma-Aldrich.

Human PKD samples. Anonymous human PKD samples were provided by Helmut Rennke (Brigham and Women’s Hospital) and used with approval of the Partners Human Research Committee, Boston, Massachusetts, USA.

Cells and mice. Pkd1–/– mice were previously described (23). Pkd1+/+ and Pkd1–/– cell lines (23) (used at passages 9–14) and Itga3+/+ and Itga3–/– cell lines (28, 63) (used at passage 6–14) were previously described. All cells were cultured in DMEM containing 2% fetal bovine serum, 0.75 μg/l γ-interferon, 1.0 g/l insulin, 0.67 mg/l sodium selenite, 0.55 g/l transferrin, 36 ng/ ml hydrocortisone, 100 U/ml penicillin/streptomycin under 33°C and 5% CO2 (64).

Lentiviral preparation, viral infection, and stable cell line generation. The lentiviral hairpin-pLKO.1 vector encoding target sequence was transfected into HEK293T cells along with pCMV-dR8.91 and VSV-G/pMD2G using TransIT-LT1, and viruses were collected from media at approximately 40 hours after transfection. Target cells grown on 6-cm dishes were infected with viruses in the presence of polybrene. Individual cell colonies were selected and isolated in the presence of puromycin at a concentration of 2.4 μg/ml. Stable cell lines were maintained in the media containing 2 μg/ml puromycin. Knockdown efficiency was analyzed by quantitative PCR and Western blot. The target sequence of the constructs were KD1: CGCTCGCACTTTCAGCAATAA; KD2: GCCCTGTACCTTTCAACCAAT; KD3: CCAACTCAACATCACCGTAAA; KD4: GCTTCACTACTCTTCCTGCTT. The primers used for Pkd1 amplification in quantitative PCR were forward primer: TCTCGGAGCAGAATCAATGCC; reverse primer: CAGAGTTGAGGGACAGTGAGAT. The control construct for knockdown experiments was a pLKO.1 empty lentiviral vector that did not contain an shRNA insert; cells derived with this vector are referred to as “Ctrl” in the figures.

Immunoprecipitation and Western blot. Immunoprecipitation and Western-blot analysis were performed using whole cell lysates unless otherwise specified. Confluent cells were collected, washed with PBS, lysed with lysis buffer (20 mM Tris/HCl, 1 mM EDTA, 150 mM NaCl, 1% Triton X-100) containing proteinase inhibitor cocktail tablet (Roche 1697498) at 4°C for 30 minutes. After centrifugation at 15,700 g for 15 minutes, supernatants were incubated with specific antibody at 4°C for 1 hour, followed by incubation with Protein G–conjugated beads (Pierce Biotechnology) at 4°C for 2 hours, and then samples were washed in lysis buffer. Samples were run on 7.5% acrylamide gel and transferred to PVDF membranes, followed by immunoblotting with specified antibodies.

Immunofluorescence. Cultured cells or cryosections (embedded in OCT and cut in a thickness of 5 μm) were fixed in cold methanol at –20°C for 10 minutes, blocked in 2% BSA for 1 hour, and incubated overnight at 4°C with primary antibody and then with Alex Fluor 488– or Alex Fluor 594–labeled secondary antibody at room temperature for 1 hour. Images were taken with the same exposure time for the same antibody.

Immunohistochemistry. Paraffin sections (5 μM) of 4% paraformaldehyde–fixed kidneys were placed in citrate-buffered solution (pH 6.0) and then boiled for 30 minutes for antigen retrieval. Endogenous peroxidase was blocked with 3% hydrogen peroxide, and nonspecific binding was blocked with 10% BSA. Diaminobenzidine substrate (Sigma-Aldrich) was used for the color reaction. Secondary antibody alone was consistently negative on all sections.

mTOR phosphorylation and activation. Pkd1–/– and WT cells were treated with either HGF (Sigma-Aldrich, 50 ng/ml, 20 minutes) or Met Kinase Inhibitor (Calbiochem, 5 μM, 4 hours). Blotting with phospho-mTOR antibody, phospho-S6K, total mTOR, or total S6K antibody was used to analyze mTOR phosphorylation and activation.

c-Met degradation. WT and Pkd1–/– cells were stimulated with 50 ng/ml HGF for 30 minutes, lysed, and subjected to Western blot analysis to determine the c-Met amount, normalized to GAPDH. Band density was measured by densitometry (Gel Doc XR, Bio-Rad), according to the manufacturer’s instructions.

Sequential precipitation with avidin and α3 integrin antibody. Confluent WT and Pkd1–/– cells were labeled with membrane-impermeable EZ-Link Sulfo-NHS-Biotin. Avidin-conjugated beads were used to pull down labeled proteins. Unlabeled α3β1 integrin in the supernatant was immunoprecipitated with the polyclonal anti–α3 integrin antibody.

Isolation of Golgi fraction. Isolation of Golgi fraction from cultured Pkd1+/+ and Pkd1–/– cells was done by using a discontinuous sucrose gradient ultracentrifugation described by Balch et al. (65). Briefly, confluent cells were harvested and washed in homogenization medium (10 mM Tris/HCl, pH 7.4, 250 mM sucrose) 2 times and homogenized in 3 ml homogenization medium, with sucrose concentration adjusted to 1.4 M. Sample solution (3.9 ml) was transferred to an approximately 11-ml ultracentrifuge tube, and the sample was overlaid with 3.9 ml of 1.2 M sucrose gradient solution and then 1.95 ml of 0.8 M sucrose gradient solution. A syringe was used to underlay the sample with 1.3 ml of 1.6 M sucrose gradient solution. Centrifugation was carried out at 4°C, 110,000 g, for 2 hours. The Golgi fraction band was harvested from the 0.8 M/1.2 M sucrose interface.

Real-time PCR. Real-time PCR was carried out on a Smart Cycler II (Cepheid). SyBR Green was used for fluorescence detection. PCR parameters were 95°C, 10 minutes (95°C, 15 seconds, 60°C, 30 seconds, 72°C, 30 seconds) 40 cycles; melting temperature was measured between 60 and 95°C. c-Met forward primer was ACGGCTGAAGGAAACCCAAG; reverse primer, ACCCAGAGTCTACGGAACAGA. The c-Met mRNA amount was normalized by the 18S RNA amount from the same cDNA sample.

Glycosylation analysis. WT and Pkd1–/– cells were lysed and incubated with Endo H and PNGase F glycosidase enzymes (New England Biolabs), following the manufacturer’s instructions for the digestion. Western blot analysis under reducing conditions with antibody against the C terminus of α3 integrin was used to evaluate the migration change before and after Endo-H and PNGase F digestion.

Organ culture in vitro. Embryonic mouse kidneys of E13.5 were dissected out and cultured in media (30) (1% FBS, 5 mg/ml transferrin, 0.05 mM sodium selenite, 100 nM hydrocortisone, 2 nM T3, 25 ng/ml PGE1, 100 U/ml penicillin/streptomycin, 100 μM 8-Br-cAMP) in a Center-Well Organ Culture Dish (BD Labware). The following day, the kidneys from the same embryo were treated with either 5 mM Met Kinase Inhibitor (Calbiochem) or DMSO (the same volume as Met Kinase Inhibitor). The media were changed every day with the same additives as above. After 5 days, kidneys were fixed by 4% PFA and embedded in paraffin. Paraffin sections were stained with hematoxylin and eosin.

Treatment of pregnant mice. Male and female Pkd1+/– mice were intercrossed to obtain homozygous mutant embryos. At E14.5, pregnant Pkd1+/– females received intraperitoneally injections of either c-Met kinase inhibitor (Calbiochem 448101) or vehicle. c-Met kinase inhibitor was dissolved in 30% DMSO/20% ethanol/50% PBS (vehicle) and injected at an amount of 100 mg/kg/d, divided into two doses, one in the morning and the other in the evening. The pregnant mice were injected at E14.5, E15.5, E16.5, and E17.5 and sacrificed at E18.5. The E18.5 embryonic kidneys were fixed in 4% PFA and genotyped, and paraffin sections were obtained and stained with hematoxylin and eosin. Cyst area was analyzed on a Nikon Eclipse 80i microscope and quantified by NIS-Elements software (Nikon Instech Co.).

Statistics. All data are presented as mean ± SEM. Student’s 2-tailed t test for unpaired groups was used to compare the mean of different groups. The difference between 2 means was significant when P was lees than 0.01.

Supplemental material

View Supplemental data

Acknowledgments

J.A. Kreidberg acknowledges support from NIH grants DK50118-01 and P50DK074030. S. Qin was supported by a Scientist Development Grant 09SDG2170031 from the American Heart Association and Fellowship Grant 180F08b from the PKD Foundation. J. Zhou acknowledges support from NIH grants P50DK074030, DK51050, DK074030, and DK40703. The authors thank Helmut Rennke for providing samples of human PKD kidneys and Valerie Schumacher, Jacqueline Ho, and Sunny Hartwig for valuable discussions.

Address correspondence to: Jordan Kreidberg, Division of Nephrology, Children’s Hospital, 300 Longwood Avenue, Boston, Massachusetts 02115, USA. Phone: 617.919.2959; Fax: 617.730.0129; E-mail: Jordan.Kreidberg@childrens.harvard.edu.

Footnotes

Conflict of interest: S. Qin and J.A. Kreidberg have a patent pending based on the results of this article.

Reference information: J Clin Invest. 2010;120(10):3617–3628. doi:10.1172/JCI41531.

References
  1. Lu W, et al. Late onset of renal and hepatic cysts in Pkd1-targeted heterozygotes. Nat Genet. 1999;21(2):160–161.
    View this article via: PubMed CrossRef Google Scholar
  2. Mochizuki T, et al. PKD2, a gene for polycystic kidney disease that encodes an integral membrane protein. Science. 1996;272(5266):1339–1342.
    View this article via: PubMed CrossRef Google Scholar
  3. Igarashi P, Somlo S. Polycystic kidney disease. J Am Soc Nephrol. 2007;18(5):1371–1373.
    View this article via: PubMed CrossRef Google Scholar
  4. Nakamura T, et al. Growth factor gene expression in kidney of murine polycystic kidney disease. J Am Soc Nephrol. 1993;3(7):1378–1386.
    View this article via: PubMed Google Scholar
  5. Matsell DG, Bennett T, Armstrong RA, Goodyer P, Goodyer C, Han VK. Insulin-like growth factor (IGF) and IGF binding protein gene expression in multicystic renal dysplasia. J Am Soc Nephrol. 1997;8(1):85–94.
    View this article via: PubMed Google Scholar
  6. Horie S, et al. Mediation of renal cyst formation by hepatocyte growth factor. Lancet. 1994;344(8925):789–791.
    View this article via: PubMed CrossRef Google Scholar
  7. Sullivan LP, et al. Sulfonylurea-sensitive K(+) transport is involved in Cl(-) secretion and cyst growth by cultured ADPKD cells. J Am Soc Nephrol. 2002;13(11):2619–2627.
    View this article via: PubMed CrossRef Google Scholar
  8. Leipziger J. Control of epithelial transport via luminal P2 receptors. Am J Physiol Renal Physiol. 2003;284(3):F419–432.
    View this article via: PubMed Google Scholar
  9. Joly D, Berissi S, Bertrand A, Strehl L, Patey N, Knebelmann B. Laminin 5 regulates polycystic kidney cell proliferation and cyst formation. J Biol Chem. 2006;281(39):29181–29189.
    View this article via: PubMed CrossRef Google Scholar
  10. Malhas AN, Abuknesha RA, Price RG. Interaction of the leucine-rich repeats of polycystin-1 with extracellular matrix proteins: possible role in cell proliferation. J Am Soc Nephrol. 2002;13(1):19–26.
    View this article via: PubMed Google Scholar
  11. Kovacs J, Carone FA, Liu ZZ, Nakumara S, Kumar A, Kanwar YS. Differential growth factor-induced modulation of proteoglycans synthesized by normal human renal versus cyst-derived cells. J Am Soc Nephrol. 1994;5(1):47–54.
    View this article via: PubMed Google Scholar
  12. Pachnis V, Mankoo B, Costantini F. Expression of the c-ret proto-oncogene during mouse embryogenesis. Development. 1993;119(4):1005–1017.
    View this article via: PubMed Google Scholar
  13. Dudley AT, Godin RE, Robertson EJ. Interaction between FGF and BMP signaling pathways regulates development of metanephric mesenchyme. Genes Dev. 1999;13(12):1601–1613.
    View this article via: PubMed CrossRef Google Scholar
  14. Kuo NT, Norman JT, Wilson PD. Acidic FGF regulation of hyperproliferation of fibroblasts in human autosomal dominant polycystic kidney disease. Biochem Mol Med. 1997;61(2):178–191.
    View this article via: PubMed CrossRef Google Scholar
  15. Santos OF, et al. Involvement of hepatocyte growth factor in kidney development. Dev Biol. 1994;163(2):525–529.
    View this article via: PubMed CrossRef Google Scholar
  16. Santos OF, Nigam SK. HGF-induced tubulogenesis and branching of epithelial cells is modulated by extracellular matrix and TGF-beta. Dev Biol. 1993;160(2):293–302.
    View this article via: PubMed CrossRef Google Scholar
  17. Konda R, Sato H, Hatafuku F, Nozawa T, Ioritani N, Fujioka T. Expression of hepatocyte growth factor and its receptor C-met in acquired renal cystic disease associated with renal cell carcinoma. J Urol. 2004;171(6 pt 1):2166–2170.
    View this article via: PubMed CrossRef Google Scholar
  18. Kreidberg JA, et al. Alpha 3 beta 1 integrin has a crucial role in kidney and lung organogenesis. Development. 1996;122(11):3537–3547.
    View this article via: PubMed Google Scholar
  19. Shannon MB, Patton BL, Harvey SJ, Miner JH. A hypomorphic mutation in the mouse laminin alpha5 gene causes polycystic kidney disease. J Am Soc Nephrol. 2006;17(7):1913–1922.
    View this article via: PubMed CrossRef Google Scholar
  20. Chang JC, Chang HH, Lin CT, Lo SJ. The integrin alpha6beta1 modulation of PI3K and Cdc42 activities induces dynamic filopodium formation in human platelets. J Biomed Sci. 2005;12(6):881–898.
    View this article via: PubMed CrossRef Google Scholar
  21. Tang K, Nie D, Cai Y, Honn KV. The beta4 integrin subunit rescues A431 cells from apoptosis through a PI3K/Akt kinase signaling pathway. Biochem Biophys Res Commun. 1999;264(1):127–132.
    View this article via: PubMed CrossRef Google Scholar
  22. Shillingford JM, et al. The mTOR pathway is regulated by polycystin-1, and its inhibition reverses renal cystogenesis in polycystic kidney disease. Proc Natl Acad Sci U S A. 2006;103(14):5466–5471.
    View this article via: PubMed CrossRef Google Scholar
  23. Nauli SM, et al. Loss of polycystin-1 in human cyst-lining epithelia leads to ciliary dysfunction. J Am Soc Nephrol. 2006;17(4):1015–1025.
    View this article via: PubMed CrossRef Google Scholar
  24. Abella JV, et al. Met/Hepatocyte growth factor receptor ubiquitination suppresses transformation and is required for Hrs phosphorylation. Mol Cell Biol. 2005;25(21):9632–9645.
    View this article via: PubMed CrossRef Google Scholar
  25. Nath D, Williamson NJ, Jarvis R, Murphy G. Shedding of c-Met is regulated by crosstalk between a G-protein coupled receptor and the EGF receptor and is mediated by a TIMP-3 sensitive metalloproteinase. J Cell Sci. 2001;114(pt 6):1213–1220.
    View this article via: PubMed Google Scholar
  26. Kaabeche K, Guenou H, Bouvard D, Didelot N, Listrat A, Marie PJ. Cbl-mediated ubiquitination of alpha5 integrin subunit mediates fibronectin-dependent osteoblast detachment and apoptosis induced by FGFR2 activation. J Cell Sci. 2005;118(pt 6):1223–1232.
    View this article via: PubMed CrossRef Google Scholar
  27. Liu Y, et al. Coordinate integrin and c-Met signaling regulate Wnt gene expression during epithelial morphogenesis. Development. 2009;136(5):843–853.
    View this article via: PubMed CrossRef Google Scholar
  28. Wang Z, Symons JM, Goldstein SL, McDonald A, Miner JH, Kreidberg JA. (Alpha)3(beta)1 integrin regulates epithelial cytoskeletal organization. J Cell Sci. 1999;112(pt 17):2925–2935.
    View this article via: PubMed Google Scholar
  29. Charron AJ, Nakamura S, Bacallao R, Wandinger-Ness A. Compromised cytoarchitecture and polarized trafficking in autosomal dominant polycystic kidney disease cells. J Cell Biol. 2000;149(1):111–124.
    View this article via: PubMed CrossRef Google Scholar
  30. Magenheimer BS, et al. Early embryonic renal tubules of wild-type and polycystic kidney disease kidneys respond to cAMP stimulation with cystic fibrosis transmembrane conductance regulator/Na(+),K(+),2Cl(-) Co-transporter-dependent cystic dilation. J Am Soc Nephrol. 2006;17(12):3424–3437.
    View this article via: PubMed CrossRef Google Scholar
  31. Meyer RB Jr, Miller JP. Analogs of cyclic AMP and cyclic GMP: general methods of synthesis and the relationship of structure to enzymic activity. Life Sci. 1974;14(6):1019–1040.
    View this article via: PubMed CrossRef Google Scholar
  32. Kasagi Y, Horiba N, Sakai K, Fukuda Y, Suda T. Involvement of cAMP-response element binding protein in corticotropin-releasing factor (CRF)-induced down-regulation of CRF receptor 1 gene expression in rat anterior pituitary cells. J Neuroendocrinol. 2002;14(7):587–592.
    View this article via: PubMed CrossRef Google Scholar
  33. Takayama H, LaRochelle WJ, Sabnis SG, Otsuka T, Merlino G. Renal tubular hyperplasia, polycystic disease, and glomerulosclerosis in transgenic mice overexpressing hepatocyte growth factor/scatter factor. Lab Invest. 1997;77(2):131–138.
    View this article via: PubMed Google Scholar
  34. Bukanov NO, Smith LA, Klinger KW, Ledbetter SR, Ibraghimov-Beskrovnaya O. Long-lasting arrest of murine polycystic kidney disease with CDK inhibitor roscovitine. Nature. 2006;444(7121):949–952.
    View this article via: PubMed CrossRef Google Scholar
  35. Lanoix J, D’Agati V, Szabolcs M, Trudel M. Dysregulation of cellular proliferation and apoptosis mediates human autosomal dominant polycystic kidney disease (ADPKD). Oncogene. 1996;13(6):1153–1160.
    View this article via: PubMed Google Scholar
  36. Torres VE. Role of vasopressin antagonists. Clin J Am Soc Nephrol. 2008;3(4):1212–1218.
    View this article via: PubMed CrossRef Google Scholar
  37. Shibazaki S, et al. Cyst formation and activation of the extracellular regulated kinase pathway after kidney specific inactivation of Pkd1. Hum Mol Genet. 2008;17(11):1505–1516.
    View this article via: PubMed CrossRef Google Scholar
  38. Happe H, et al. Toxic tubular injury in kidneys from Pkd1-deletion mice accelerates cystogenesis accompanied by dysregulated planar cell polarity and canonical Wnt signaling pathways. Hum Mol Genet. 2009;18(14):2532–2542.
    View this article via: PubMed CrossRef Google Scholar
  39. Takakura A, Contrino L, Beck AW, Zhou J. Pkd1 inactivation induced in adulthood produces focal cystic disease. J Am Soc Nephrol. 2008;19(12):2351–2363.
    View this article via: PubMed CrossRef Google Scholar
  40. Ohnishi H, Mizuno S, Nakamura T. Inhibition of tubular cell proliferation by neutralizing endogenous HGF leads to renal hypoxia and bone marrow-derived cell engraftment in acute renal failure. Am J Physiol Renal Physiol. 2008;294(2):F326–335.
    View this article via: PubMed CrossRef Google Scholar
  41. Ramos-Nino ME, et al. HGF mediates cell proliferation of human mesothelioma cells through a PI3K/MEK5/Fra-1 pathway. Am J Respir Cell Mol Biol. 2008;38(2):209–217.
    View this article via: PubMed CrossRef Google Scholar
  42. Piontek K, Menezes LF, Garcia-Gonzalez MA, Huso DL, Germino GG. A critical developmental switch defines the kinetics of kidney cyst formation after loss of Pkd1. Nat Med. 2007;13(12):1490–1495.
    View this article via: PubMed CrossRef Google Scholar
  43. Lelongt B, Carone FA, Kanwar YS. Decreased de novo synthesis of proteoglycans in drug-induced renal cystic disease. Proc Natl Acad Sci U S A. 1988;85(23):9047–9051.
    View this article via: PubMed CrossRef Google Scholar
  44. Jin H, Carone FA, Nakamura S, Liu ZZ, Kanwar YS. Altered synthesis and intracellular transport of proteoglycans by cyst-derived cells from human polycystic kidneys. J Am Soc Nephrol. 1992;2(12):1726–1733.
    View this article via: PubMed Google Scholar
  45. Ehara T, Carone FA, McCarthy KJ, Couchman JR. Basement membrane chondroitin sulfate proteoglycan alterations in a rat model of polycystic kidney disease. Am J Pathol. 1994;144(3):612–621.
    View this article via: PubMed Google Scholar
  46. Beavan LA, Carone FA, Nakamura S, Jones JK, Reindel JF, Price RG. Comparison of proteoglycans synthesized by porcine normal and polycystic renal tubular epithelial cells in vitro. Arch Biochem Biophys. 1991;284(2):392–399.
    View this article via: PubMed CrossRef Google Scholar
  47. Charron AJ, Bacallao RL, Wandinger-Ness A. ADPKD: a human disease altering Golgi function and basolateral exocytosis in renal epithelia. Traffic. 2000;1(8):675–686.
    View this article via: PubMed CrossRef Google Scholar
  48. Carone FA, Jin H, Nakamura S, Kanwar YS. Decreased synthesis and delayed processing of sulfated glycoproteins by cells from human polycystic kidneys. Lab Invest. 1993;68(4):413–418.
    View this article via: PubMed Google Scholar
  49. Aydar E, Palmer CP. Polycystic kidney disease channel and synaptotagmin homologues play roles in schizosaccharomyces pombe cell wall synthesis/repair and membrane protein trafficking. J Membr Biol. 2009;229(3):141–152.
    View this article via: PubMed Google Scholar
  50. Lai AZ, Abella JV, Park M. Crosstalk in Met receptor oncogenesis. Trends Cell Biol. 2009;19(10):542–551.
    View this article via: PubMed CrossRef Google Scholar
  51. Bacallao RL, McNeill H. Cystic kidney diseases and planar cell polarity signaling. Clin Genet. 2009;75(2):107–117.
    View this article via: PubMed CrossRef Google Scholar
  52. Fischer E, et al. Defective planar cell polarity in polycystic kidney disease. Nat Genet. 2006;38(1):21–23.
    View this article via: PubMed CrossRef Google Scholar
  53. Saburi S, et al. Loss of Fat4 disrupts PCP signaling and oriented cell division and leads to cystic kidney disease. Nat Genet. 2008;40(8):1010–1015.
    View this article via: PubMed CrossRef Google Scholar
  54. Patel V, et al. Acute kidney injury and aberrant planar cell polarity induce cyst formation in mice lacking renal cilia. Hum Mol Genet. 2008;17(11):1578–1590.
    View this article via: PubMed CrossRef Google Scholar
  55. Apte U, et al. Activation of Wnt/beta-catenin pathway during hepatocyte growth factor-induced hepatomegaly in mice. Hepatology. 2006;44(4):992–1002.
    View this article via: PubMed CrossRef Google Scholar
  56. Yu W, O’Brien LE, Wang F, Bourne H, Mostov KE, Zegers MM. Hepatocyte growth factor switches orientation of polarity and mode of movement during morphogenesis of multicellular epithelial structures. Mol Biol Cell. 2003;14(2):748–763.
    View this article via: PubMed CrossRef Google Scholar
  57. Yoder BK. Role of primary cilia in the pathogenesis of polycystic kidney disease. J Am Soc Nephrol. 2007;18(5):1381–1388.
    View this article via: PubMed CrossRef Google Scholar
  58. Yoder BK, Hou X, Guay-Woodford LM. The polycystic kidney disease proteins, polycystin-1, polycystin-2, polaris, and cystin, are co-localized in renal cilia. J Am Soc Nephrol. 2002;13(10):2508–2516.
    View this article via: PubMed CrossRef Google Scholar
  59. Poole CA, Zhang ZJ, Ross JM. The differential distribution of acetylated and detyrosinated alpha-tubulin in the microtubular cytoskeleton and primary cilia of hyaline cartilage chondrocytes. J Anat. 2001;199(pt 4):393–405.
    View this article via: PubMed CrossRef Google Scholar
  60. Follit JA, Tuft RA, Fogarty KE, Pazour GJ. The intraflagellar transport protein IFT20 is associated with the Golgi complex and is required for cilia assembly. Mol Biol Cell. 2006;17(9):3781–3792.
    View this article via: PubMed CrossRef Google Scholar
  61. Tenkova T, Chaldakov GN. Golgi-cilium complex in rabbit ciliary process cells. Cell Struct Funct. 1988;13(5):455–458.
    View this article via: PubMed CrossRef Google Scholar
  62. Girod C, Lheritier M, Guichard Y. (Cilia-centriole-Golgi apparatus relationships in the glandular cells of the anterior pituitary of the hedgehog [Erinaceus europaeus L]). C R Seances Acad Sci D. 1980;290(11):711–714.
    View this article via: PubMed Google Scholar
  63. Chattopadhyay N, Wang Z, Ashman LK, Brady-Kalnay SM, Kreidberg JA. alpha3beta1 integrin-CD151, a component of the cadherin-catenin complex, regulates PTPmu expression and cell-cell adhesion. J Cell Biol. 2003;163(6):1351–1362.
    View this article via: PubMed CrossRef Google Scholar
  64. Nauli SM, Kawanabe Y, Kaminski JJ, Pearce WJ, Ingber DE, Zhou J. Endothelial cilia are fluid shear sensors that regulate calcium signaling and nitric oxide production through polycystin-1. Circulation. 2008;117(9):1161–1171.
    View this article via: PubMed CrossRef Google Scholar
  65. Balch WE, Dunphy WG, Braell WA, Rothman JE. Reconstitution of the transport of protein between successive compartments of the Golgi measured by the coupled incorporation of N-acetylglucosamine. Cell. 1984;39(2 pt 1):405–416.
    View this article via: PubMed CrossRef Google Scholar
Version history
  • Version 1 (September 13, 2010): No description
  • Version 2 (October 1, 2010): No description

Article tools

  • View PDF
  • Download citation information
  • Send a comment
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal

Metrics

  • Article usage
  • Citations to this article

Go to

  • Top
  • Abstract
  • Introduction
  • Results
  • Discussion
  • Methods
  • Supplemental material
  • Acknowledgments
  • Footnotes
  • References
  • Version history
Advertisement
Advertisement

Copyright © 2026 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)

Sign up for email alerts