Go to JCI Insight
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Journal stats
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
  • Clinical Research and Public Health
  • Current issue
  • Past issues
  • By specialty
    • COVID-19
    • Cardiology
    • Gastroenterology
    • Immunology
    • Metabolism
    • Nephrology
    • Neuroscience
    • Oncology
    • Pulmonology
    • Vascular biology
    • All ...
  • Videos
    • ASCI Milestone Awards
    • Video Abstracts
    • Conversations with Giants in Medicine
  • Reviews
    • View all reviews ...
    • The cGAS-STING pathway: DNA sensing in health and disease (Jun 2026)
    • Neurodegeneration (Mar 2026)
    • Clinical innovation and scientific progress in GLP-1 medicine (Nov 2025)
    • Pancreatic Cancer (Jul 2025)
    • Complement Biology and Therapeutics (May 2025)
    • Evolving insights into MASLD and MASH pathogenesis and treatment (Apr 2025)
    • Microbiome in Health and Disease (Feb 2025)
    • View all review series ...
  • Viewpoint
  • Collections
    • In-Press Preview
    • Clinical Research and Public Health
    • Research Letters
    • Letters to the Editor
    • Editorials
    • Commentaries
    • Editor's notes
    • Reviews
    • Viewpoints
    • 100th anniversary
    • Top read articles

  • Current issue
  • Past issues
  • Specialties
  • Reviews
  • Review series
  • ASCI Milestone Awards
  • Video Abstracts
  • Conversations with Giants in Medicine
  • In-Press Preview
  • Clinical Research and Public Health
  • Research Letters
  • Letters to the Editor
  • Editorials
  • Commentaries
  • Editor's notes
  • Reviews
  • Viewpoints
  • 100th anniversary
  • Top read articles
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Journal stats
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
Top
  • View PDF
  • Download citation information
  • Send a comment
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal
  • Top
  • Abstract
  • Introduction
  • Results
  • Discussion
  • Methods
  • Author contributions
  • Conflict of interest
  • Funding support
  • Supplemental material
  • Acknowledgments
  • Footnotes
  • References
  • Version history
  • Article usage
  • Citations to this article

Advertisement

Research ArticleCell biologyEndocrinologyMetabolism Open Access | 10.1172/JCI173913

Pancreatic islet α cell function and proliferation require the arginine transporter SLC7A2

Erick Spears,1,2 Jade E. Stanley,1,3 Matthew Shou,1 Linlin Yin,3 Xuan Li,3 Chunhua Dai,1 Amber Bradley,1 Katelyn Sellick,1 Greg Poffenberger,1 Katie C. Coate,1,3 Shristi Shrestha,1 Anna Marie R. Schornack,1 Taverlyn Shepard,1,3 Madushika Wimalarathne,1 Regina Jenkins,1 Kyle W. Sloop,5 Keith T. Wilson,6,7,8,9,10 Alan D. Attie,4 Mark P. Keller,4 Wenbiao Chen,3 Alvin C. Powers,1,3,10 and E. Danielle Dean1,3

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Spears, E. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Stanley, J. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Shou, M. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Yin, L. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Li, X. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Dai, C. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Bradley, A. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Sellick, K. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Poffenberger, G. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Coate, K. in: PubMed | Google Scholar |

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Shrestha, S. in: PubMed | Google Scholar |

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Schornack, A. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Shepard, T. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Wimalarathne, M. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Jenkins, R. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Sloop, K. in: PubMed | Google Scholar |

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Wilson, K. in: PubMed | Google Scholar |

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Attie, A. in: PubMed | Google Scholar |

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Keller, M. in: PubMed | Google Scholar |

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Chen, W. in: PubMed | Google Scholar

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Powers, A. in: PubMed | Google Scholar |

1Division of Diabetes, Endocrinology, and Metabolism, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee, USA.

2Department of Biology, Belmont University, Nashville, Tennessee, USA.

3Department of Molecular Physiology & Biophysics, Vanderbilt University, Nashville, Tennessee, USA.

4Department of Biochemistry, University of Wisconsin–Madison, Madison, Wisconsin, USA.

5Diabetes and Complications, Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana, USA.

6Division of Gastroenterology, Hepatology & Nutrition, Department of Medicine;

7Department of Pathology, Microbiology & Immunology;

8Center for Mucosal Inflammation & Cancer; and

9Program in Cancer Biology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA.

10Veterans Affairs Tennessee Valley Healthcare System, Nashville, Tennessee, USA.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Authorship note: ES and JES contributed equally to this work.

Find articles by Dean, E. in: PubMed | Google Scholar |

Authorship note: ES and JES contributed equally to this work.

Published June 15, 2026 - More info

Published in Volume 136, Issue 12 on June 15, 2026
J Clin Invest. 2026;136(12):e173913. https://doi.org/10.1172/JCI173913.
© 2026 Spears et al. This work is licensed under the Creative Commons Attribution 4.0 International License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
Published June 15, 2026 - Version history
Received: August 3, 2023; Accepted: April 23, 2026
View PDF
Abstract

Interrupting glucagon signaling decreases gluconeogenesis and the fractional extraction of amino acids by liver from blood, resulting in lower glycemia. The resulting hyperaminoacidemia stimulates α cell proliferation and glucagon secretion via a liver/α cell axis. We hypothesized that α cells detect and respond to circulating amino acids’ levels via a unique amino acid transporter repertoire. We found that Slc7a2/SLC7A2 is the most highly expressed cationic amino acid transporter in α cells, with its expression being 3-fold greater in α than β cells in both mouse and human. Employing cell culture, zebrafish, and knockout mouse models, we found that the cationic amino acid arginine and SLC7A2 are required for α cell proliferation in response to interrupted glucagon signaling. Ex vivo and in vivo assessment of islet function in Slc7a2–/– mice showed decreased arginine-stimulated glucagon and insulin secretion. We found that arginine activation of mTOR signaling and induction of the glutamine transporter SLC38A5 was dependent on SLC7A2, showing that the role of both in α cell proliferation is dependent on arginine transport and SLC7A2. Finally, we identified single nucleotide polymorphisms in SLC7A2 associated with HbA1c. Together, these data indicate a central role for SLC7A2 in amino acid–stimulated α cell proliferation and islet hormone secretion.

Introduction

Pancreatic α cells secrete glucagon, which stimulates gluconeogenesis and glycogenolysis in the liver when blood glucose concentrations are low. When glucose levels rise, β cells secrete insulin, which counteracts these effects. The counterregulatory relationship between these 2 hormones is essential to maintenance of glucose homeostasis. The development of type 2 diabetes (T2D) results from reduced insulin secretion from pancreatic islets and diminished insulin action in peripheral tissues. However, hyperglucagonemia in T2D, due to the inability to suppress glucagon secretion, also promotes T2D-associated hyperglycemia, highlighting a central role for α cell dysregulation in addition to insulin insufficiency (1). Interrupting glucagon action lowers blood glucose under non-diabetic conditions and in rodent models and humans with diabetes (2–5). Therefore, glucagon receptor antagonism is under investigation as a therapeutic approach to treat both type 1 diabetes (T1D) and T2D (6–8). Studies of glucagon antagonism led to the discovery of an interaction between the α cells in the pancreatic islet and hepatocytes that has been termed the liver/α cell axis. Interrupted glucagon signaling decreases hepatic amino acid extraction from the circulation and catabolism, resulting in hyperaminoacidemia. This in turn feeds back to α cells, stimulating them to proliferate and secrete more glucagon. This response to interrupted glucagon signaling by any approach (e.g., small molecule antagonist, genetic deletion of the glucagon gene, glucagon receptor, or downstream signaling components) is conserved in zebrafish, mouse, and human islets (9–14).

Most recently, studies have identified high glutamine as being important for this amino acid–stimulated α cell proliferation and involving the mTOR-dependent upregulation of expression of the glutamine transporter Slc38a5 (9, 10). These studies also indicated roles for other amino acids in the liver/α cell axis, as elevated levels of glutamine were essential, but not sufficient, suggesting a role for a combination of other amino acids, like those found in serum of mice with interrupted glucagon signaling (10). Furthermore, global loss of Slc38a5 expression reduced, but did not completely prevent, α cell proliferation following glucagon signaling interruption (9).

Arginine has profound physiological effects on islet cells as a potent secretagogue for both insulin and glucagon (15–19). The most common arginine transporters belong to the Slc7a subfamily of y+-type cationic amino acid transporters historically known as CAT proteins (SLC7A1–4 and SLC7A14) (20). Of all these subfamily members, SLC7A2 is the most highly expressed in human pancreas and liver (https://gtexportal.org/home/). In mice, Slc7a2 expression was decreased in the liver in response to interrupted glucagon signaling, and this was accompanied by an increase in serum arginine (9, 10). Though SLC7A2 and arginine transport have been studied in other tissues and cell types, including macrophages, astrocytes, lung, and intestine (21–24), its role in islet cell physiology has not been assessed.

These observations led us to hypothesize that arginine plays a central role in the liver/α cell axis and that SLC7A2 is the primary arginine transporter in α cells. Here, we show that Slc7a2 is highly expressed in α and β cells from humans, mice, and zebrafish and that arginine is required for amino acid–stimulated α cell proliferation. Using genetic loss-of-function models in zebrafish and mice, we demonstrate that SLC7A2 is required for amino acid–stimulated α cell proliferation following interrupted glucagon signaling and that it plays a critical role in arginine-stimulated insulin and glucagon secretion from pancreatic β or α cells, respectively. Finally, we demonstrated that Slc7a2 expression is required for the upregulation of Slc38a5 expression following interrupted glucagon signaling. Together, these studies reveal a conserved role for the arginine transporter SLC7A2 in amino acid–regulated islet cell biology.

Results

Arginine is necessary for amino acid–stimulated α cell proliferation in vitro. Previous studies demonstrated the importance of hyperaminoacidemia for α cell proliferation and specifically a role for glutamine and its major transporter, SLC38A5, in mice and zebrafish (9, 10). Since Slc38a5 expression differs between mouse and human α cells and its ablation only partially suppressed α cell proliferation (9, 10), we evaluated whether other amino acids are individually required for amino acid–stimulated α cell proliferation, as is glutamine. As described previously, culturing isolated mouse islets in high amino acid medium increased α cell proliferation (Figure 1A) (10). This high amino acid medium (All AA +) mimicked levels in mice with interrupted glucagon signaling while low amino acid medium (All AA –) was similar to levels in wild-type mouse serum (Supplemental Table 1; supplemental material available online with this article; https://doi.org/10.1172/JCI173913DS1). To identify other critical amino acids, we adopted a 2-step approach to minimize the number of islets in the screen. As a first step, we reduced the levels of groups of 4 amino acids in the high amino acid medium (Supplemental Table 1). Only islets cultured in medium with low arginine, histidine, glycine, and asparagine (RHGNlo) had decreased α cell proliferation (Figure 1A). To determine if a low level of a single amino acid in the RHGNlo medium was responsible, we then individually replaced each of these 4 amino acids in the RHGNlo medium at the high concentration and found that only arginine (R) stimulated amino acid–stimulated α cell proliferation (Figure 1B). We also assessed the importance of arginine for proliferation of a cultured α cell line, αTC1-6 cells. Culturing these cells in their normal DMEM-based medium lacking arginine inhibited proliferation (Figure 1C and Supplemental Table 2). These results indicate that arginine, in addition to glutamine, is required for α cell proliferation (10).

Arginine stimulates α cell proliferation in cultured mouse islets and catioFigure 1

Arginine stimulates α cell proliferation in cultured mouse islets and cationic amino acid transporter, Slc7a2, expression is conserved in human, mouse, and zebrafish α cells. (A) Ex vivo α cell proliferation analysis in low (All AA-) and high (All AA+) amino acid–containing medium; medium with low concentrations of amino acids (AIKMVOPSTYRHGN-); high AA medium with alanine (A), isoleucine (I), lysine (K), methionine (M), and valine (V) at low concentrations (AIKMV-); high AA medium with ornithine (O), proline (P), serine (S), threonine (T), and tryptophan (Y) at low concentrations (OPSTY-); AA medium with arginine (R), histidine (H), glycine (G), and asparagine (N) at low concentrations (RHGN–). (B) Ex vivo α cell proliferation analysis in low (–) and high (+) amino acid–containing medium, in otherwise high AA medium with low RHGN concentrations (orange bar, RHGN-), and with each of the low-concentration AAs in low RHGN medium restored to high levels (gray bars, R+, H+, G+, and N+). We determined α cell proliferation by percent Ki67+/Gcg+ cells per total Gcg+ cells in isolated islets cultured in medium containing different variations of amino acid concentrations (n = 3 per group). AA = all amino acids, R = arginine, H = histidine, G = glycine, N = asparagine, + = high AA concentrations (equivalent to that in serum of Gcgr–/– mice), – = low AA concentration (equivalent to that in serum of Gcgr+/+). (C) Cell growth over time of αTC1-6 cultured cells in control DMEM or in DMEM lacking glutamine (Gln), arginine (Arg), or both. (D–F) Comparison of cationic amino acid transporter expression in α and β cells from published (D) human (n = 5) (25, 26), (E) mouse (n = 3–4) (27), and (F) zebrafish (n = 3) (28) RNA-seq datasets. Expression of other cationic amino acid transporter not shown was below the limits of detection in islet cells. Significance was designated: **P < 0.005, and ****P < 0.0001.

Slc7a2 is highly expressed in pancreatic α and β cells. Because interruption of glucagon signaling leads to increased serum amino acids and increased α cell proliferation (9, 10), we evaluated the expression of cationic amino acid transporters in pancreatic α and β cells by mining published transcriptomics datasets. In human RNA-seq datasets (25, 26), SLC7A2 is the most highly expressed of all SLC (SoLute Carrier) superfamily genes in α cells, and its expression is 3-fold higher in α cells than in β cells (Figure 1D and Supplemental Table 3). From mouse RNA-seq data (27), Slc7a2 is one of the most highly expressed amino acid transporters, with a 6-fold greater expression in α cells when compared with β cells (Figure 1E and Supplemental Table 3). In zebrafish (28), slc7a2 is the third most highly expressed amino acid transporter (Supplemental Table 3) but is the most highly expressed cationic amino acid transporter (Figure 1F). The greater level of Slc7a2 expression in islet cells of humans, mice, and zebrafish points toward its evolutionarily conserved importance in the endocrine pancreas and α cells.

SLC7A2 is associated with hemoglobin A1c levels in humans. To ask if SLC7A2 contributes to nutrient homeostasis in humans, we investigated if the SLC7A2 gene locus is associated with diabetes-related phenotypes in human GWAS. Two single nucleotide polymorphisms (SNPs) have been identified within the first intron of SLC7A2 that are associated with hemoglobin A1c (HbA1c) levels (Figure 2A). rs142010226 (chr 8, 17367112:A/G) and rs2517232 (chr 8, 17367421:A/G) are both strongly associated (P < 10–15) with HbA1c in the EXTEND human cohort, which consists of 1,395 diabetic and 5,764 non-diabetic individuals of European ancestry, which we identified via data mining the T2D Knowledge Portal (29). Further data mining of published ATAC-seq and ChIP-seq datasets from human islets (Figure 2B) showed that both SNPs occur within ~1 kb of binding sites for MAFB and FOXA2, 2 transcription factors (30, 31) that have previously been shown to be critical for α cell gene expression (32–35). In summary, these findings are consistent with a role for SLC7A2 in glucose homeostasis in humans and suggest that genetic variants associated with HbA1c may influence MAFB- and/or FOXA2-dependent regulation of SLC7A2 expression in islets.

GWAS analysis of the SLC7A2 gene locus identifies SNPs associated with HbA1Figure 2

GWAS analysis of the SLC7A2 gene locus identifies SNPs associated with HbA1c in human. (A) SNPs significantly associated with the human SLC7A2 gene locus with HbA1c levels are represented by a violet diamond (rs142010226) and a yellow (rs2517232) circle. Gray circles represent SNPs not significantly associated with HbA1c or for which there are no associated data, respectively. Yellow shading indicates the region identified in B. LD, linkage disequilibrium. (B) ATAC-seq analyses, from Pasquali et al. (29), of the SLC7A2 locus in human islets with highly conserved regions (blue, Cons.), ATAC peaks in green, FOXA2 binding in red, and MAFB binding in purple.

Slc7a2–/– mice have decreased arginine-stimulated glucagon and insulin secretion. To understand the role of arginine transport in islet function and α cell proliferation, we examined the impact of loss of Slc7a2 on glucose homeostasis and islet function using a global Slc7a2-knockout (Slc7a2–/–)mouse line (21–23, 36). We found that Slc7a2–/– mice had normal glucose tolerance in response to intraperitoneal glucose injection (Supplemental Figure 1, A and B). To assess stimulated islet hormone secretion and glycemic regulation, we gave Slc7a2–/– mice an intraperitoneal glucose/arginine bolus, and blood glucose, serum glucagon, and serum insulin concentrations were measured (Figure 3, A–C). Stimulated blood glucose levels were higher in Slc7a2–/– than in Slc7a2+/+ mice (Figure 3A), supporting a role for SLC7A2 in glycemic regulation. Serum glucagon levels increased similarly in Slc7a2+/+ and Slc7a2+/– after stimulation with glucose and arginine. However, stimulated glucagon levels in Slc7a2–/– mice were 60% lower than their Slc7a2+/+ and Slc7a2+/– littermates and not different from fasted glucagon levels in the same Slc7a2–/– mice (Figure 3B). Similar to glucose/arginine bolus, intraperitoneal administration of arginine alone did not increase serum glucagon in Slc7a2–/– animals, as stimulated values were 95% lower than Slc7a2+/+ mice and not significantly different from fasted glucagon values in the same mice (Figure 3E), indicating a central role for SLC7A2 in arginine-stimulated glucagon secretion.

Slc7a2–/– mice have decreased glucagon and insulin secretion under highly sFigure 3

Slc7a2–/– mice have decreased glucagon and insulin secretion under highly stimulatory conditions. (A) Blood glucose, (B) serum glucagon, and (C) serum insulin for Slc7a2+/+ (n = 11), Slc7a2+/– (n = 8), and Slc7a2–/– (n = 12) mice fasted for 6 hours, injected with glucose/arginine bolus, and sampled 15 minutes after injection. (D) Blood glucose, (E) serum glucagon, and (F) serum insulin for Slc7a2+/+, Slc7a2+/–, and Slc7a2–/– mice fasted for 6 hours, injected with arginine bolus, and sampled 15 minutes after injection (n = 8 each genotype). (G) Glucagon secretion, (H) glucagon content, (I) insulin secretion, and (J) insulin content as assessed by perifusion of islets isolated from Slc7a2+/+ and Slc7a2–/– mice (n = 4 each genotype). G 1 = 1 mM glucose, G 11 = 11 mM glucose, Arg 20 = 20 mM arginine, KCl 20 = 20 mM KCl. *P < 0.05, **P < 0.005, ***P < 0.0005, and ****P < 0.0001.

Interestingly, glucose/arginine-stimulated serum insulin levels were similarly decreased in Slc7a2–/– animals, but there was also a decrease in glucose/arginine-stimulated serum insulin in Slc7a2+/– animals (Figure 3C). Intraperitoneal administration of arginine resulted in no change in blood glucose for Slc7a2–/– compared with Slc7a2+/+ and Slc7a2+/– mice (Figure 3D). Arginine did not increase serum insulin levels in Slc7a2–/– mice, and arginine-stimulated insulin levels were also lower in Slc7a2+/– mice (Figure 3F). These data indicate that arginine transport via SLC7A2 is necessary for arginine-stimulated glucagon and insulin secretion. Of note, the decrease in arginine-stimulated insulin secretion in Slc7a2+/– mice indicates that arginine transport may be the rate limiting step in stimulated glucagon and insulin secretion.

Slc7a2–/– mouse islets have an islet-intrinsic impaired response to arginine resulting in defective glucagon secretion. Because we used a global Slc7a2-knockout mouse, we assessed whether the observed defects in arginine-stimulated secretion in vivo were due to intrinsic islet SLC7A2 loss (islet autonomous) or mediated by extra-islet signals by perifusing isolated islets from Slc7a2–/– mice and Slc7a2+/+ littermates with glucose, arginine, or a combination of the two. Basal glucagon secretion from Slc7a2–/– islets was low, even at low glucose, and arginine did not stimulate glucagon secretion from these isolated islets (Figure 3G). This appears to be due to a secretory defect in Slc7a2–/– α cells, as glucagon content was similar in Slc7a2+/+ and Slc7a2–/– islets (Figure 3H), and membrane depolarization with KCl failed to stimulate glucagon secretion as it robustly did in Slc7a2+/+ islets (Figure 3G). Arginine-stimulated insulin secretion was impaired in the Slc7a2–/– islets (Figure 3I), again, with no difference in insulin content (Figure 3J). KCl-stimulated and second phase glucose-stimulated insulin secretion was also impaired in Slc7a2–/– islets but not absent.

Taken together, these data indicate an islet-autonomous secretory defect in Slc7a2–/– α and β cells. Additionally, interrupted glucagon signaling does not influence the pattern of secretory profile in response to stimuli; rather, the genotype predicts the secretory response, including no response to the glucose/arginine bolus, in Slc7a2–/– mice (Supplemental Figure 3). However, the overall amount of glucagon was increased 5-fold in all genotypes by monoclonal antibody targeting the glucagon receptor (GCGR mAb) treatment versus IgG Ab–treated littermates, suggesting that glucagon secretion in Slc7a2–/– mice is blunted but not completely lost in response to other amino acids that are not transported by SLC7A2.

Slc7a2–/– mice have normal islet morphology and endocrine cell mass and islet-specific gene expression. Slc7a2–/– mice have elevated SLC7A2-transported amino acids (e.g., arginine, lysine, and ornithine) (24). While these amino acids showed the greatest increases in Slc7a2–/– mice, we observed modest elevations in several other serum amino acids, including glutamine (Supplemental Figure 1J). To assess whether this slight elevation of amino acids, as compared with that of mice with interrupted glucagon signaling, is associated with increased α cell mass in the Slc7a2–/– mice, we performed immunofluorescence staining on pancreas sections from these mice. Islets from Slc7a2–/– mice had normal islet architecture and morphology (Figure 4, A and B) and no difference in α, β, or δ cell mass (Figure 4, C–F), similar to no difference being observed in the glucagon or insulin content of isolated islets (Figure 3, H and J).

SLC7A2 is required for α cell proliferation in response to interrupted glucFigure 4

SLC7A2 is required for α cell proliferation in response to interrupted glucagon signaling. (A and B) Representative immunostaining for C-peptide, glucagon, and somatostatin from Slc7a2+/+ and Slc7a2–/– mouse pancreas (scale bar = 50 mm). (C–E) Mass analysis for α (C), β (D), and δ (E) cells and total islet mass (F) from Slc7a2+/+ (n = 7) and Slc7a2–/– (n = 9) mice. (G–J) Representative images of islets from Slc7a2+/+ and Slc7a2–/– mouse pancreas after 2 weeks of treatment with GCGR mAb or control IgG (scale bar = 50 μm; inset K–N scale bar = 10 μm). (O) Quantification of α cell proliferation as determined by percent Ki67+/Gcg+ cells per total Gcg+ cells in Slc7a2+/+ and Slc7a2–/– mouse islets after 2 weeks of treatment with GCGR mAb or control IgG (n = 5 each). (P–R) Representative images of 5 dpf islets from Tg(gcga:EGFP) zebrafish, α cell–specific EGFP, with CRISPR/Cas9-induced loss of glucagon receptors (gcgra/b) and/or slc7a2 stained for EdU to assess proliferation (scale bar = 20 μm). (S) Quantification of total α cell numbers (n = 14, 18, 29, 46, and 20, respectively, for each genotype) and (T) quantification of EdU-positive α cells from zebrafish islets (n = 12, 18, and 9, respectively, for each genotype). **P < 0.005, ***P < 0.0005, and ****P < 0.0001.

Interrupted glucagon signaling–stimulated α cell proliferation requires Slc7a2 expression. Treatment of mice with a GCGR mAb interrupted glucagon signaling and stimulated α cell proliferation as previously shown (4, 9, 10). To investigate the role of SLC7A2 in α cell proliferation, we treated Slc7a2+/+ and Slc7a2–/– with IgG Ab or GCGR mAb (Figure 4, G–O). In Slc7a2+/+ mice, 2 weeks of treatment with GCGR mAb resulted in a greater than 6.8-fold increase in the percentage of Ki67-positive α cells (Figure 4, I, M, and O). Slc7a2–/– mice, treated in the same way, showed a 66% reduction in α cell proliferation (Figure 4, J, N, and O).

In a second model, we used a complementary zebrafish model of interrupted glucagon signaling to assess the role of Slc7a2 expression in α cell proliferation. We previously described a gcgr-knockout zebrafish model with increased α cell proliferation and numbers (12). Deletion of slc7a2 by CRISPR targeting in gcgr-null zebrafish decreased the total number of α cells and 5-ethynyl-2′-deoxyuridine–positive (EdU-positive) α cells at day 5 postfertilization (5 dpf) to wild-type fish levels, indicating that Slc7a2 is necessary for α cell proliferation in response to interrupted glucagon signaling in the developing zebrafish islet (Figure 4, P–T).

Together, these studies in mouse and zebrafish models of interrupted glucagon signaling indicate that SLC7A2 is necessary for α cell proliferation.

SLC7A2 dependence of stimulated α cell proliferation is islet cell autonomous. To evaluate whether reduced α cell proliferation in Slc7a2–/– mice is an islet-autonomous or an extra-islet effect, we first evaluated SLC7A2-dependent proliferation in clonal αTC1-6 shRNA cell lines. Two separately selected monoclonal Slc7a2 shRNA lines showed decreased SLC7A2 protein as compared with a non-targeting (scrambled) shRNA–expressing line (Figure 5A). Evaluation of growth of these monoclonal lines over 8 days demonstrated that SLC7A2 loss reduced proliferation in these cells, with cell numbers approximately 65% lower in Slc7a2 shRNA lines (Figure 5A). These data, when combined with the findings presented in Figure 1C, indicate that arginine and SLC7A2 are necessary for growth of the αTC1-6 mouse α cell line.

SLC7A2-dependent stimulated α cell proliferation is islet autonomous.Figure 5

SLC7A2-dependent stimulated α cell proliferation is islet autonomous. (A) Cell growth over time of αTC1-6 cultured cells expressing Slc7a2 shRNA (2 clones) or non-targeting (scrambled) control shRNA (n = 4 each). Immunoblot (below) shows decreased SLC7A2 protein in the Slc7a2 shRNA lines. (B) Ex vivo α cell proliferation from isolated mouse islets cultured in low (–) and high (+) amino acid–containing medium as determined by percent Ki67+/Gcg+ cells per total Gcg+ cells in islets isolated from Slc7a2+/+, Slc7a2+/–, and Slc7a2–/– mice (n = 4 each). (C) Schematic of kidney capsule transplantation of Slc7a2–/– and Slc7a2+/+ islets into Slc7a2+/+ recipient mouse followed by glucagon receptor monoclonal antibody treatment. (D–G) Representative images of Slc7a2+/+ and Slc7a2–/– islet grafts from Slc7a2+/+ kidney capsules after 2 weeks of treatment with glucagon receptor monoclonal antibody (GCGR mAb) or control IgG (scale bar = 50 μm; inset H–K scale bar = 10 μm). Dashed yellow lines indicate kidney graft boundary. (L) Percent α cell proliferation from Slc7a2+/+ and Slc7a2–/– islets transplanted into Slc7a2+/+ kidney capsule and treated with GCGR mAb or control IgG (n = 8 transplant recipients, n = 4 per treatment group). *P < 0.05, ***P < 0.0005, and ****P < 0.0001.

Isolated islets from Slc7a2–/– mice had a 90% reduction in α cell proliferation when cultured in high amino acids (Figure 5B). Interestingly, proliferation of Slc7a2+/– α cells was approximately 60% lower than Slc7a2+/+, suggesting that the level of Slc7a2 expression may be rate limiting for proliferative response to arginine.

To test islet autonomy in vivo, we transplanted isolated islets from Slc7a2–/– mice into Slc7a2+/+ recipients, placing the knockout islets into the physiological environment of a wild-type mouse. Each recipient mouse also had Slc7a2+/+ islets transplanted into the contralateral kidney to serve as a control for stimulated α cell proliferation. After engraftment, recipient mice were treated weekly with either the GCGR mAb or the control IgG for an additional 2 weeks to investigate the consequence of interrupted glucagon signaling (Figure 5C). Immunostaining analysis of kidney grafts indicated that interrupted glucagon signaling increased α cell proliferation 4.5-fold in the Slc7a2+/+ islet grafts, but α cell proliferation in Slc7a2–/– grafts was not different from control, IgG treatment (Figure 5, D–L). Thus, these in vitro and in vivo data together indicate that SLC7A2 dependence of stimulated α cell proliferation is likely a result of SLC7A2 function in α cells.

mTORC1 activity is required for arginine- and SLC7A2-dependent α cell proliferation. Stimulated α cell proliferation has been mechanistically linked to mTOR complex 1 (mTORC1) signaling and increased phosphorylation of ribosomal protein S6 (phospho-S6), a target of mTORC1 (10). Glutamine has previously been shown to regulate α cell proliferation in an mTOR-dependent manner (10); however, absence of glutamine alone does not fully eradicate the proliferative effect of glucagon receptor–antagonized wild-type mice. Therefore, to assess whether arginine transport through SLC7A2 could affect mTORC1 activity in α cells, we quantified phospho-S6 expression by immunostaining pancreas sections from wild-type or Slc7a2–/– mice. We observed reduced phospho-S6 expression levels in α cells of GCGR mAb–treated Slc7a2–/– mice to similar levels as IgG-treated wild-type and Slc7a2–/– mice when compared with GCGR mAb–treated wild-type mice. This suggests that the inactivation of the SLC7A2 transporter can reduce mTOR activity in glucagon receptor–antagonized mice (Figure 6, A–I, and Supplemental Figure 4, A–D). To determine if arginine can similarly regulate mTORC1 activity, mouse islets were isolated and dispersed into single cells, cultured in high amino acid conditions or high amino acid conditions with low glutamine or arginine concentrations, followed by phospho-S6 immunofluorescence (Figure 6J). We observed a 2.2-fold reduction in phospho-S6235/236 expression in the high amino acid conditions with either low arginine or low glutamine, suggesting that removal of arginine or glutamine can reduce mTORC1 activation correspondingly. The data insinuate that arginine and SLC7A2 may regulate α cell proliferation in an mTORC1-dependent manner.

Arginine and SLC7A2 regulate mTORC1 activity.Figure 6

Arginine and SLC7A2 regulate mTORC1 activity. (A–D) Immunostaining of GCGR mAb– and IgG-treated Slc7a2+/+ and Slc7a2–/– mouse islets for glucagon and phospho-ribosomal protein S6 (P-S6235/236), indicating active mTOR signaling (scale bar = 50 μm; inset E–H scale bar = 10 μm). (I) Quantification of α cell mTOR activation as determined by percent PS6+/Gcg+ cells (P-S6235/236) per total Gcg+ cells in Slc7a2+/+ and Slc7a2–/– mouse islets after 2 weeks of treatment with GCGR mAb or control IgG (n = 4–12 each). (J) Quantification of α cell mTOR activation as determined by percent PS6+/Gcg+ cells per total Gcg+ cells in Slc7a2+/+ and Slc7a2–/– cytospun dispersed mouse islets after 4-day culture in high amino acids, high amino acids with low arginine (R), or high amino acids with low glutamine (Q) (n = 4). *P < 0.05, **P < 0.005, ***P < 0.0005.

Stimulated Slc38a5 expression during interrupted glucagon signaling is SLC7A2 dependent. Previous studies showed that interrupted glucagon signaling stimulates expression of Slc38a5, a neutral amino acid/glutamine transporter, in mouse and zebrafish α cells, and that this is partially required for mTOR-dependent α cell proliferation in an elevated amino acid environment associated with interrupted glucagon signaling in liver (9, 10). To test whether Slc38a5 expression was SLC7A2 dependent, we evaluated the presence of SLC38A5 in α cells of GCGR mAb–treated Slc7a2–/– mice and Slc7a2+/+ littermates by immunofluorescence (Figure 7, A–I). As expected, SLC38A5 was detected in greater than 60% of GCGR mAb–treated Slc7a2+/+ α cells versus 10% in IgG-treated littermates. Interestingly, less than 20% of Slc7a2–/– α cells showed detectable SLC38A5 similar to IgG-treated mice of either genotype (Figure 7, A–I). Isolated Slc7a2–/– islets transplanted into the kidney capsules of Slc7a2+/+ mice subsequently treated with GCGR mAb also lacked this stimulated SLC38A5 expression (Figure 7, K–R). Isolated islets from Slc7a2–/– mice treated with GCGR mAb also had impaired induction of Slc38a5 gene expression (Figure 7J). To further assess the connection between SLC7A2 and SLC38A5, mouse islets were isolated and dispersed into single cells, cultured in high amino acid conditions, or high amino acid conditions with low glutamine or arginine concentrations, followed by SLC38A5 immunofluorescence (Figure 7S). SLC38A5+ α cells were reduced in conditions with high amino acid concentrations coupled with either low glutamine or low arginine concentrations. No significant differences were found between low arginine and low glutamine exposure, indicating arginine and glutamine are equally important for the induction of the glutamine transporter SLC38A5. Overall, these data suggest that arginine transport through SLC7A2 is required for the induced gene expression of the glutamine transporter SLC38A5 observed during interrupted glucagon signaling (Figure 8).

SLC7A2 is required for upregulation of Slc38a5 expression during interrupteFigure 7

SLC7A2 is required for upregulation of Slc38a5 expression during interrupted glucagon signaling. (A–D) Representative images of islets from Slc7a2+/+ and Slc7a2–/– mouse pancreas stained for glucagon (green) and SLC38A5 (red) after 2 weeks of treatment with GCGR mAb or control IgG (scale bar = 50 μm; inset E–H scale bar = 10 μm). (I) Quantification of SLC38A5 expression in α cells by percent SLC38A5+/GCG+ cells per total Gcg+ cells (% SLC38A5+ α cells) in Slc7a2+/+ and Slc7a2–/– mouse islets after injection with GCGR mAb or control IgG (n = 4–5). (J) Quantification of Slc38a5 mRNA levels assessed by quantitative PCR in Slc7a2+/+ and Slc7a2–/– mice treated with IgG or GCGR mAb. (K–N) Representative images of Slc7a2+/+ and Slc7a2–/– islet grafts from Slc7a2+/+ kidney capsules after 2 weeks of treatment with GCGR mAb or control IgG and stained for glucagon and SLC38A5 (scale bar = 50 μm; inset O–R scale bar = 10 μm). Dashed yellow lines indicate kidney graft boundary. (S) Quantification of SLC38A5 in α cells as determined by percent SLC8A5+/Gcg+ cells per total Gcg+ cells in wild-type mouse islets after 4-day culture in high amino acid–containing medium (High AA) or in otherwise high AA medium with low arginine (Low R) or low glutamine (Low Q). *P < 0.05, **P < 0.005, ***P < 0.0005, ****P < 0.00005.

Model of α cell response to elevated amino acids during interrupted glucagoFigure 8

Model of α cell response to elevated amino acids during interrupted glucagon signaling. SLC7A2 is required for arginine-stimulated glucagon secretion and α cell proliferation. Arginine transported into the α cell through SLC7A2 initially stimulates glucagon secretion (Acute AAHigh). The buildup of intracellular arginine ultimately stimulates mTOR-dependent Slc38a5 expression through metabolism or other physiological mechanisms (Chronic AAHigh). Transport of glutamine through SLC38A5 stimulates α cell proliferation as described previously (9, 10). Created with BioRender.com.

Discussion

Arginine is a major substrate for SLC7A2 transport and a known potent secretagogue for both pancreatic islet α and β cells. We found that SLC7A2, one of the most highly expressed amino acid transporter genes in α cells in mice and humans, plays a central role in islet function. Loss of Slc7a2 expression in mice resulted in impaired arginine-stimulated glucagon and insulin secretion in vivo and ex vivo. Slc7a2 expression is also required for amino acid–stimulated α cell proliferation in zebrafish and mice. Together, our data indicate that SLC7A2 is the primary arginine transporter in islet cells regulating arginine’s effects on hormone secretion. Our work also provides strong evidence that arginine stimulation of hormone secretion works by an alternative mechanism than what has been previously suggested (37). These studies also directly link SLC7A2 function with the previous observation that glutamine transport through SLC38A5 is necessary for α cell proliferation by demonstrating that arginine transport through SLC7A2 is required for mTOR activation and upregulation of Slc38a5 expression (see model, Figure 8). Finally, we show that SNPs in the SLC7A2 gene are associated with HbA1c, a common clinical value used to evaluate glycemic status. These roles for SLC7A2 in α cells described here support its designation as an α cell “signature gene” (38).

Previous studies suggested that arginine transport results in membrane depolarization due to the cationic properties of arginine (39). Yet, glucagon secretion from Slc7a2–/– islets was not stimulated in perifusion experiments even with the strong depolarizing agent KCl, while glucagon content and overall α cell mass were not different (Figure 3G). This suggests that impaired hormone secretion when SLC7A2 expression is lost represents a fundamental defect in secretory mechanisms or machinery versus secretory capacity and not simply perturbations in membrane polarity. Yet, islet transcriptomics studies in Slc7a2–/– and Slc7a2+/+ islets did not reveal any insight into a possible mechanism (e.g., changes in ion channel or vesicle machinery expression; Supplemental Figure 2). Furthermore, there remains uncertainty as to whether the observed insulin secretion defect is β cell autonomous or the result of impaired paracrine signaling from α cells. Interestingly, early studies with the perfused rat pancreas showed that arginine rapidly and potently stimulates glucagon secretion under no glucose conditions whereas its effect on insulin secretion is slow and tonic, requiring several minutes for appreciable insulin secretion. This suggests that SLC7A2 transport levels limit the response by islet cells to arginine (40) similar to the intermediate effect of an arginine bolus on insulin levels in Slc7a2+/– mice versus Slc7a2–/– mice observed in this study. However, under high-glucose conditions, both glucagon and insulin are rapidly and potently secreted in response to arginine. This indicates that factors other than SLC7A2 transporter levels may limit β cell responses to arginine. The glucose dependency observed in this study is similar to responses observed with incretin-stimulated insulin secretion where incretins have little effect on insulin secretion under low glycemic or euglycemic conditions. Intra-islet glucagon signaling through both glucagon and GLP-1 receptor signaling in β cells required for arginine-stimulated insulin secretion (40, 41). We observed a modest decrease in glucose-stimulated insulin secretion in Slc7a2–/– islets, while arginine-stimulated insulin secretion was profoundly perturbed, in addition to a loss of glucagon secretion. Therefore, we predict that much of arginine’s effect on β cells might be paracrine in nature, mediated via proglucagon-derived peptides linked to the α cell’s robust expression of SLC7A2. To understand whether the loss of arginine-stimulated insulin secretion in Slc7a2–/– mice results from the intrinsic loss of SLC7A2 from β cells or whether it is the result of the observed loss of glucagon secretion, new models are necessary (a pseudoislet system composed of mixing Slc7a2–/– α cells with Slc7a2+/+ β cells or newly generated α and β cell–specific Slc7a2-knockout mice). Therefore, further study is needed to determine how arginine and SLC7A2 promote secretion.

Human islets have been shown to have a splicing quantitative trait locus for the SLC7A2 gene, which are known to regulate alternative splice events of pre-mRNA (42). Thus, the SNPs within this region could result in altered splicing products from the gene locus. SLC7A2/Slc7a2 is alternatively spliced at exon 7, yielding 2 protein isoforms, CAT2A and CAT2B (20). While both exons appear to be expressed in α and β cells, α cells predominately express the second exon 7 associated with SLC7A2A (CAT2A) isoform, and β cells prefer the first exon 7 associated with SLC7A2B (CAT2B). This suggests that α cells have higher levels of CAT2A, a low-affinity (Km 2–5 mM), high-capacity arginine transporter. This difference, in addition to overall higher expression, might grant α cells the ability to sense rising levels of arginine better than other islet cells. Our analysis of the association to HbA1c levels in the EXTEND GWAS dataset suggests that individuals with either of 2 SNPs within the first intron of SLC7A2 have reduced HbA1c levels (i.e., negative β values). It is unclear if this association is due to glycemia, as only a third of variance in HbA1c levels in non-diabetic individuals is due to factors such as glycemia and body mass index (42). Interestingly, SLC7A2 is downregulated in both T1D and T2D human α cells and may reflect observed downregulation of MAFB/MAFB under both conditions (25, 43–45). In mouse islets, Slc7a2 expression is positively correlated with the expression of Foxa2 and Mafb (46). That these SNPs are proximal to binding sites for MAFB and FOXA2 in human islets suggests that they may influence their binding and subsequent regulation of SLC7A2 expression. However, it is unclear where SLC7A2 expression is driving such associations, since MAFB is expressed in both human α and β cells and FOXA2 is expressed in both α cells and liver. Despite associations of SNPs in SLC7A2 with improved long-term glucose homeostasis in humans, Slc7a2–/– mice had normal fasting glucose and glucose tolerance when assessed by acute intraperitoneal glucose injection. To test if the incretin system affected blood glucose levels in the absence of SLC7A2 transport, we performed an oral mixed meal tolerance test (Supplemental Figure 1, D–F). We observed no changes in glucose tolerance even with an activated incretin system. However, our study supports that arginine regulation of hormone secretion itself may be the driver behind the association and not glucose disposal per se.

Our work connects arginine signaling to glutamine signaling by showing Slc7a2–/– mice lack the increased expression of the glutamine transporter, Slc38a5, seen in Slc7a2+/+ α cells, and described in previous studies (9, 10), when glucagon signaling is interrupted. SLC38A5 is associated with mTOR-mediated increased proliferation (10), which we show is SLC7A2 dependent. In addition to amino acid–dependent mTORC1 signaling (Figure 6), others and we have shown that additional signaling pathways through the calcium sensor receptor, ERK, and ERBB3 growth factor are required for α cell proliferation (47–51). Together, these findings suggest a potential connection between SLC7A2- and mTOR-mediated α cell proliferation.

Cancer cells also upregulate amino acid transport and metabolic pathways to facilitate their growth but under nutrient-limiting conditions. In cancer cells, arginine-dependent regulation of cytosolic CASTOR1 and lysosomal SLC38A9 and TM4SF5 proteins promotes mTOR activation leading to proliferation (52). Whether these pathways for arginine-stimulated proliferation are conserved in non-transformed cells including α cells is unclear. In contrast with the present study, SLC7A2 expression is negatively correlated with proliferation in breast cancer, colon cancer, hepatocellular carcinoma, and ovarian cancer (53–56). SLC7A2 is highly expressed in multiple normal tissues, including liver, breast, skeletal muscle, and islets. Thus, the role of SLC7A2 in cell proliferation and physiology in general merits cell type–specific targeting for further study.

It was surprising that no difference in α cell mass was observed in untreated Slc7a2–/– mice, since SLC7A2 was required for adaptive growth in response to hyperaminoacidemia and glucagon secretion was nearly absent under our conditions. This suggests that other mechanisms might also determine baseline α cell mass. However, we predict that there is sufficient glucagon signal in the liver in these mice to not fully activate the liver/α cell axis as with pharmacological or genetic targeting glucagon receptors. This hypothesis is supported by the observation that while Slc7a2–/– mice have mild hyperaminoacidemia, blood levels of amino acids such as glutamine and arginine are 3- to 5-fold lower than levels observed in mice with interrupted glucagon signaling (9–11). Expression of Slc38a5 is greatly increased in α cells during interrupted glucagon signaling, and it is the only amino acid transporter that responds as such. Interestingly, Slc38a5–/– mice showed only 50% lower α cell proliferation during interrupted glucagon signaling than wild-type mice, indicating that other amino acids or transporters are required for the α cell proliferative response (9). These observations led us to hypothesize that other amino acids may play an essential role in α cell proliferation.

Arginine plays several critical physiological roles, including controlling vasodilation through the synthesis of nitric oxide, immune function, and removing ammonia from the body via production of urea. Glucagon facilitates ureagenesis by both transcriptional and posttranslational control of the urea cycle in liver. Conversely, several amino acids, including arginine, potently stimulate glucagon secretion. Together, these events form an endocrine feedback loop called the liver/α cell axis, where α cells play a critical role in the sensing of circulating amino acids (Figure 8) (1, 57). When arginine levels rise acutely (e.g., minutes to hours), such as with a protein meal, arginine transport via SLC7A2 leads to glucagon secretion. Similarly, chronic hyperargininemia (e.g., days or longer), such as with interruption of glucagon signaling in liver, and prolonged arginine accumulation via SLC7A2 lead to mTOR activation in α cells and activation of gene expression (including other amino acid/glutamine transporters, such as Slc38a5) that facilitate cell proliferation.

The discovery that interrupted glucagon signaling stimulates human α cell proliferation (4, 14) and that human α cells can transdifferentiate into β cells (58) holds promise for the use of glucagon receptor antagonists for the reestablishment of β cell mass after diabetic loss as has been recently demonstrated in mice (4). Safely expanding α cells could also represent the first step in restoring β cell mass through α-to-β cell transdifferentiation. Further studies are needed to address the molecular mechanisms by which arginine stimulates glucagon secretion and arginine interacts with the mTOR pathway in α cells to stimulate Slc38a5 expression and proliferation, whether transport of other amino acids is required for these responses, and whether these mechanisms are conserved in human islets.

Methods

Further information can be found in Supplemental Methods.

Sex as biological variable. Both male and female mice were combined in these studies, as there were no differences in response to intervention observed between sexes.

Mouse studies. All mouse studies were performed at Vanderbilt University Medical Center and approved by the Institutional Animal Care and Use Committee. Mice were housed on a 12-hour light/dark cycle with ad libitum access to standard rodent chow (unless indicated for fasting purposes) and water. Slc7a2–/– mice (Jackson Laboratory, B6.129S7-Slc7a2tm1Clm/LellJ) and Slc7a2+/– and Slc7a2+/+ littermates from heterozygous crosses were used for all mouse experiments. To interrupt glucagon signaling, mice were treated weekly with 10 mg/kg of a humanized monoclonal antibody targeting the glucagon receptor (GCGR mAb “Ab-4”) intraperitoneally once a week for 2 weeks (59).

For contralateral islet transplantations, 100–150 islets isolated from 14- to 16-week-old Slc7a2–/– donor mice were transplanted under the left kidney capsule, and an equivalent number of Slc7a2+/+ donor islets were transplanted under the right kidney capsule of an Slc7a2+/+ recipient mouse. Two weeks after transplantation, transplant recipients were given 2 weekly treatments of GCGR mAb as described in Figure 5C and above. After 2 weeks of GCGR mAb treatment, kidneys containing grafts were retrieved, bisected at the grafts, fixed in 4% paraformaldehyde, embedded in OCT (Thermo Fisher Scientific), and stored at –80°C until sectioning (14, 60).

Zebrafish studies. The role of Slc7a2 in proliferation of α cells in zebrafish (Danio rerio) was studied using a previously described (12) glucagon receptor double-knockout line expressing GFP under the control of the glucagon promoter to identify α cells: Tg(gcga:GFP);gcgra/b–/–. Using CRISPR/Cas9 technology, a 62 bp deletion was created in slc7a2 (using the sgRNA GGGTAAGCGCCAGTCGCCAG and the PAM TGG for targeting). We assessed total α cells by counting GFP+ cells in the islets of 5 dpf fish as described previously (12). To identify proliferating α cells, embryos were incubated with 1 mmol/L EdU at 4 dpf and chased for 24 hours. EdU was detected according to published protocols (12) and using the Click-iT EdU Alexa Fluor 594 Imaging Kit (C10339; Invitrogen). All images were collected using a Zeiss LSM880 confocal microscope (Carl Zeiss).

Tissue collections from mice. After treatment periods, pancreata were collected. Histology samples were fixed in 4% paraformaldehyde, embedded in OCT, and stored at –80°C until use. For transplantation, islet RNA, and ex vivo proliferation experiments, islets were isolated by intraductal infusion of collagenase P and histopaque gradient separation (both MilliporeSigma).

Stimulated glucagon and insulin secretion in vivo. To assess the role of SLC7A2 in glucagon and insulin secretion, Slc7a2+/+, Slc7a2+/–, and Slc7a2–/– mice were fasted for 6 hours and then injected intraperitoneally with glucose, arginine, or both to final concentrations of 2 g/kg body weight each. Blood was collected retroorbitally before injection (fasting) and 15 minutes after injection (stimulated). Blood glucose was measured with a handheld glucometer (Accu-Check Aviva), and remaining whole blood was spun. Serum was collected into separate tubes and stored at –80°C for glucagon and insulin analyses.

Serum hormones were analyzed in the Vanderbilt Hormone and Analytical Services core. Serum glucagon was analyzed in a 2-site enzyme sandwich ELISA (Mercodia). Serum insulin was analyzed by dual antibody radioimmunoassay and counted in a Packard Gamma counter.

Immunofluorescence staining and image analysis. To compare islet cell masses in untreated Slc7a2+/+ and Slc7a2–/– mice, pancreata from 14- to 16-week-old mice were prepared for histology as described above. Whole mouse pancreas was sectioned on a cryostat at a thickness of 8 mm per section. The full depth of the pancreas was sectioned by 7 repeated steps of sectioning away 150 mm and collecting 10 sections onto slides. In this way 7 depths of 150 mm were collected from each pancreas. For islet cell mass analysis, 1 section from each of the 7 depths was stained for C-peptide (Invitrogen, PA-85595) to mark β cells, glucagon (LSBio, LS-C202759) to mark α cells, and somatostatin (Santa Cruz Biotechnology, sc-7819) to mark δ cells. Whole pancreatic sections were imaged on Scanscope FL System (Aperio Technologies), and islet cell areas were analyzed using Halo image analysis software (Indica Labs). Total pancreatic islet cell masses were calculated as described previously (61). Briefly, islet cell areas from each of 7 depths were normalized to total pancreas section area, areas from each of the 7 sections were summed, and the sum was multiplied by total pancreas mass to achieve an estimate of the percentage of total mass.

For α cell proliferation analysis, pancreata from mice treated for 2 weeks with GCGR mAb were sectioned and immunostained for the proliferation marker, Ki67 (Abcam, ab15580), and glucagon to mark α cells. Whole sections were imaged on the Scanscope and analyzed on Halo software. Percent α cell proliferation was calculated from at least 1,000 α cells per animal by dividing Ki76+/glucagon+ cells by total glucagon+ cells. Similarly, percent Slc38a5+ α cells was calculated by staining for Slc38a5 (Santa Cruz Biotechnology, sc-50682) and glucagon, with imaging and analyzing as above. Amino acid–stimulated α cell proliferation has been shown to be mTOR dependent. We verified this mTOR dependence by staining for a target of mTOR1 activity, phosphorylation of ribosomal protein S6 (Cell Signaling Technology: pS6235/236, 4858S; pS6240/244, 5364S), and glucagon.

Kidney grafts were sectioned at 5 mm per section, and approximately 20 sections were collected for each graft. These sections were immunostained for glucagon and Ki67 to assess percent α cell proliferation from at least 500 α cells per graft. Grafts were also stained for glucagon and SLC38A5 to assess α cell–specific expression of the transporter during interrupted glucagon signaling.

Ex vivo α cell proliferation. Ex vivo α cell proliferation was assessed as described previously (10). Briefly, islets isolated from Slc7a2–/–, Slc7a2+/–, and Slc7a2+/+ mice were cultured in DMEM-based medium with high or low amino acid concentrations, based on amino acid levels in Gcgr–/– and Gcgr+/+ mouse serum, respectively (see Supplemental Table 1 for amino acid concentrations in islet culture media), for 72 hours. See Figure 1, A and B, for ex vivo α cell proliferation analysis.

After culture, islets were washed in 2 mM EDTA and dispersed with 0.025% trypsin at 37°C for 10 minutes with mixing. Dispersed islet cells were recovered by centrifugation at 1,000g in RPMI media containing 5.6 mM glucose, 10% FBS, and 1% Penicillin/Streptomycin. The resulting cell pellet was resuspended in medium and centrifuged onto a glass slide using a Cytospin 4 (Thermo Fisher Scientific) centrifuge. We used 800 rpm for 3 minutes. Slides were air-dried for 30 minutes, then stored at –80°C until use. For staining, slides were thawed, immediately fixed in 4% paraformaldehyde, and immunostained for glucagon, to mark α cells, and Ki67, to mark proliferating cells. Slides were imaged using a Leica Microsystems Epifluorescent Microscope DM1 6000B. The percent of proliferating α cells was calculated based on the number of Ki67+/glucagon+ cells divided by the total number of glucagon+ cells using Imaris image analysis software (Oxford Instruments).

αTC1-6 cell culture. αTC1 clone 6 (αTC1-6) cells were obtained from ATCC (CRL-2934) and maintained in DMEM, low glucose (Gibco 11885-084), with 10% FBS, 15 mM HEPES, 0.1 mM non-essential amino acids, 0.02% bovine serum albumin, and 1% Penicillin/Streptomycin (Supplemental Table 2). To test the roles for arginine and glutamine in growth of these cells, SILAC DMEM Flex Media (Gibco, A24939-01), which lacks arginine, glutamine, and lysine, was used as base medium, prepared as above, and supplemented with lysine to produce No Gln / No Arg control medium. The control medium was supplemented with 0.4 mM arginine (No Gln / 0.4 mM Arg) or 4 mM glutamine (4 mM Gln / No Arg) or both (4 mM Gln / 0.4 mM Arg) to test the effects of glutamine and arginine on αTC1-6 cell growth. To assess cell growth, 6-well plates were seeded with 1 × 105 cells/well (day 0) in standard culture medium and allowed to normalize overnight. Cells from 1 well in each 6-well plate were collected and counted (day 1) in a Countess 3 automated cell counter (Thermo Fisher Scientific). Media were changed in the remaining wells to experimental media described above, and cells were allowed to grow for 3 days. Beginning on day 4, cells from 1 well in each media condition were collected and counted, and growth curves were established (Figure 1C).

To establish the requirement for SLC7A2 in αTC1-6 cell growth, monoclonal lines expressing Slc7a2 shRNA or a scrambled (non-targeting) shRNA control were established. Cells were transduced with lentivirus expressing Slc7a2 shRNA (VectorBuilder vector no. VB170727-1121dxf) or scrambled shRNA (VectorBuilder vector no. VB170313-1108xyf), each expressing a puromycin resistance cassette and a GFP fluorescence marker. Transduced cells were selected with 2.5 mg/mL Puromycin Dihydrochloride (Corning, 61-385-RA) to produce polyclonal lines expressing these shRNAs. Polyclonal lines were seeded at a density of 1 cell per well in 96-well plates and allowed to grow into single colonies in each well. Colonies were expanded and selected based on Slc7a2 expression (Figure 5A, Western blot). Cell growth of these monoclonal shRNA lines was assessed as described above in basal DMEM-based medium.

Analysis of published RNA-seq datasets. Normalized RNA-seq data were obtained from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) repository. Published datasets for sorted human (25, 26), mouse (27), and zebrafish (28) α and β cells were selected for comparison of transporter expression between the 2 cell types. Human and zebrafish expression data were normalized with TMM method, and mouse data were normalized to RPKM. Normalized expression data for all solute carriers (SLC genes) in α and β cells were sorted from highest to lowest expression, and the top 50 in each cell type are given in Supplemental Table 3. The 5 most highly expressed cationic amino acid transporters in α cells, sorted from highest to lowest, are shown for all 3 species in Figure 1, D–F.

Whole islet RT-PCR. For RT-PCR analyses, Slc7a2+/+ and Slc7a2–/– mice were treated with IgG or GCGR mAb or untreated. Islets were isolated as described above. RNA was isolated from whole islets. Trace DNA was removed with the RNAqueous micro total RNA isolation kit (Thermo Fisher Scientific). RNA integrity was evaluated by Agilent 2100 Bioanalyzer. cDNA was synthesized from high-integrity (RIN > 7) total RNA using HighCapacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s instructions. mRNA levels were assessed by quantitative PCR using the TaqMan assay system. Deletion of Slc7a2 was validated by exon 2–specific quantitative real-time RT-PCR on RNA isolated from Slc7a2–/– and wild-type littermate (Slc7a2+/+) islets (Supplemental Figure 2B). Primers were purchased from Thermo Fisher Scientific: Actb (internal control), Mm02619580_g1; Slc7a2, Mm00432032_m1; and Slc38a5, Mm00549967_m1.

In vitro islet perifusion. Function of isolated Slc7a2+/+ and Slc7a2–/– islets was studied in a dynamic cell perifusion system at a perifusate flow rate of 1 mL/min as described previously (25, 62). Stimulus concentrations and exposure times are shown in Figure 3 traces. The effluent was collected at 3-minute intervals using an automatic fraction collector. Glucagon and insulin concentrations in each perifusion fraction and islet extracts were measured by radioimmunoassay (MilliporeSigma).

Statistics. All data are shown with error bars indicating standard error of the mean. Data within individual experiments were compared with ordinary 1-way ANOVA using Tukey’s correction for multiple comparisons, unless otherwise designated in the figure legend. P < 0.05 was considered statistically significant.

Study approval. All mouse studies were performed at Vanderbilt University Medical Center and approved by the Institutional Animal Care and Use Committee.

Data availability. All RNA-seq data are from previously published studies and available in public repositories as indicated above. Any additional data are in the Supporting Data Values file or available from the corresponding author upon request.

Author contributions

EDD, WC, and ACP contributed to conceptualization. WC, ACP, EDD, MPK, KWS, JES, and ADA contributed to funding acquisition. ES, EDD, JES, MS, WS, CD, AB, KWS, MPK, GP, LY, RJ, KS, KCC, SS, AMRS, TS, MW, KTW, and XL contributed to investigation. WC, ACP, and EDD contributed to supervision. ES and EDD wrote the original draft. ES, EDD, JES, ACP, WC, MPK, AMRS, KCC, and KWS contributed to writing – review & editing. All authors approved the final manuscript.

Conflict of interest

KWS is an employee of Eli Lilly & Co.

Funding support

This work is the result of NIH funding, in whole or in part, and is subject to the NIH Public Access Policy. Through acceptance of this federal funding, the NIH has been given a right to make the work publicly available in PubMed Central.

  • Breakthrough T1D SRA-149-Q-R (to ACP and EDD).
  • NIH R01DK117147 (to WC and ACP).
  • NIH R01DK132669 (to EDD).
  • American Heart Association 24TPA1278431 (to EDD).
  • NIH F31DK134158 (to JES).
  • NIH T32DK007563 (to JES and AMRS).
  • NIH R25GM134979 (to TS).
  • NIH K01DK117969 (to EDD).
  • University of Wisconsin–Madison, Department of Biochemistry and Office of the Vice Chancellor for Research and Graduate Education with funding from the Wisconsin Alumni Research Foundation (MPK).
  • NIH grant R01DK101573 (to ADA).
  • NIH grant R01DK102948 (to ADA).
  • NIH grant RC2DK125961 (to ADA).
  • NIH grant R01DK128200 (to KTW).
  • NIDDK-supported Human Islet Research Network (UC4 DK104211 and DK112232).
  • NIH DK106755 (to ACP).
  • VUMC’s Digestive Diseases Research Center (P30 DK058404).
  • Department of Veterans Affairs BX000666.
  • Department of Veterans Affairs I01CX002171.
  • Vanderbilt Cell Imaging Shared Resource, supported by NIH grants OD021630, CA68485, DK20593, DK58404, DK59637, and EY08126.
  • Islet and Pancreas Analysis Core and the Hormone Assay and Analysis Core of Vanderbilt Diabetes Research and Training Center (P30 DK020593).
Supplemental material

View Supplemental data

View Unedited blot and gel images

View Supporting data values

Acknowledgments

We would like to thank Lesley Ellies, University of California, San Diego San Diego, California, USA, for sharing the Slc7a2–/– mice with us.

Address correspondence to: E. Danielle Dean, 2215 Garland Ave., Medical Research Bldg IV Rm 7435G, Nashville, Tennessee 37232, USA. Phone: 615.875.8993; Email: danielle.dean@vumc.org.

Footnotes

Copyright: © 2026, Spears et al. This is an open access article published under the terms of the Creative Commons Attribution 4.0 International License.

Reference information: J Clin Invest. 2026;136(12):e173913.https://doi.org/10.1172/JCI173913.

References
  1. Wewer Albrechtsen NJ, et al. The liver-α-cell axis and type 2 diabetes. Endocr Rev. 2019;40(5):1353–1366.
    View this article via: CrossRef PubMed Google Scholar
  2. Gelling RW, et al. Lower blood glucose, hyperglucagonemia, and pancreatic alpha cell hyperplasia in glucagon receptor knockout mice. Proc Natl Acad Sci U S A. 2003;100(3):1438–1443.
    View this article via: CrossRef PubMed Google Scholar
  3. Johnson DG, et al. Hyperglycemia of diabetic rats decreased by a glucagon receptor antagonist. Science. 1982;215(4536):1115–1116.
    View this article via: CrossRef PubMed Google Scholar
  4. Wang MY, et al. Glucagon blockade restores functional β-cell mass in type 1 diabetic mice and enhances function of human islets. Proc Natl Acad Sci U S A. 2021;118(9):e2022142118.
    View this article via: CrossRef PubMed Google Scholar
  5. Kazda CM, et al. Evaluation of efficacy and safety of the glucagon receptor antagonist LY2409021 in patients with type 2 diabetes: 12- and 24-week phase 2 studies. Diabetes Care. 2016;39(7):1241–1249.
    View this article via: CrossRef PubMed Google Scholar
  6. Pettus J, et al. Effect of a glucagon receptor antibody (REMD-477) in type 1 diabetes: a randomized controlled trial. Diabetes Obes Metab. 2018;20(5):1302–1305.
    View this article via: CrossRef PubMed Google Scholar
  7. Kostic A, et al. A first-in-human pharmacodynamic and pharmacokinetic study of a fully human anti-glucagon receptor monoclonal antibody in normal healthy volunteers. Diabetes Obes Metab. 2018;20(2):283–291.
    View this article via: CrossRef PubMed Google Scholar
  8. Morgan ES, et al. Antisense inhibition of glucagon receptor by IONIS-GCGRRx improves type 2 diabetes without increase in hepatic glycogen content in patients with type 2 diabetes on stable metformin therapy. Diabetes Care. 2019;42(4):585–593.
    View this article via: CrossRef PubMed Google Scholar
  9. Kim J, et al. Amino acid transporter Slc38a5 controls glucagon receptor inhibition-induced pancreatic α cell hyperplasia in mice. Cell Metab. 2017;25(6):1348–1361.
    View this article via: CrossRef PubMed Google Scholar
  10. Dean ED, et al. Interrupted glucagon signaling reveals hepatic α cell axis and role for L-glutamine in α cell proliferation. Cell Metab. 2017;25(6):1362–1373.
    View this article via: CrossRef PubMed Google Scholar
  11. Solloway MJ, et al. Glucagon couples hepatic amino acid catabolism to mTOR-dependent regulation of α-cell mass. Cell Rep. 2015;12(3):495–510.
    View this article via: CrossRef PubMed Google Scholar
  12. Li M, et al. Glucagon receptor inactivation leads to α-cell hyperplasia in zebrafish. J Endocrinol. 2015;227(2):93–103.
    View this article via: CrossRef PubMed Google Scholar
  13. Wewer Albrechtsen NJ, et al. Evidence of a liver-alpha cell axis in humans: hepatic insulin resistance attenuates relationship between fasting plasma glucagon and glucagonotropic amino acids. Diabetologia. 2018;61(3):671–680.
    View this article via: CrossRef PubMed Google Scholar
  14. Longuet C, et al. Liver-specific disruption of the murine glucagon receptor produces α-cell hyperplasia: evidence for a circulating α-cell growth factor. Diabetes. 2013;62(4):1196–1205.
    View this article via: CrossRef PubMed Google Scholar
  15. Akesson B, et al. Islet constitutive nitric oxide synthase and glucose regulation of insulin release in mice. J Endocrinol. 1999;163(1):39–48.
    View this article via: CrossRef PubMed Google Scholar
  16. Henningsson R, Lundquist I. Arginine-induced insulin release is decreased and glucagon increased in parallel with islet NO production. Am J Physiol. 1998;275(3):E500–E506.
    View this article via: PubMed CrossRef Google Scholar
  17. Armour SL, et al. Metabolic regulation of glucagon secretion. J Endocrinol. 2023;259(1):e230081.
    View this article via: CrossRef PubMed Google Scholar
  18. Gerich JE, et al. Characterization of the effects of arginine and glucose on glucagon and insulin release from the perfused rat pancreas. J Clin Invest. 1974;54(4):833–841.
    View this article via: JCI CrossRef PubMed Google Scholar
  19. Sener A, et al. Stimulus-secretion coupling of arginine-induced insulin release: comparison with lysine-induced insulin secretion. Endocrinology. 1989;124(5):2558–2567.
    View this article via: CrossRef PubMed Google Scholar
  20. Fotiadis D, et al. The SLC3 and SLC7 families of amino acid transporters. Mol Aspects Med. 2013;34(2-3):139–158.
    View this article via: CrossRef PubMed Google Scholar
  21. Nicholson B, et al. Sustained nitric oxide production in macrophages requires the arginine transporter CAT2. J Biol Chem. 2001;276(19):15881–15885.
    View this article via: CrossRef PubMed Google Scholar
  22. Manner CK, et al. CAT2 arginine transporter deficiency significantly reduces iNOS-mediated NO production in astrocytes. J Neurochem. 2003;85(2):476–482.
    View this article via: CrossRef PubMed Google Scholar
  23. Rothenberg ME, et al. Cationic amino acid transporter 2 regulates inflammatory homeostasis in the lung. Proc Natl Acad Sci U S A. 2006;103(40):14895–14900.
    View this article via: CrossRef PubMed Google Scholar
  24. Singh K, et al. Deletion of cationic amino acid transporter 2 exacerbates dextran sulfate sodium colitis and leads to an IL-17-predominant T cell response. Am J Physiol Gastrointest Liver Physiol. 2013;305(3):G225–G240.
    View this article via: CrossRef PubMed Google Scholar
  25. Brissova M, et al. α Cell function and gene expression are compromised in type 1 diabetes. Cell Rep. 2018;22(10):2667–2676.
    View this article via: CrossRef PubMed Google Scholar
  26. Saunders DC, et al. Ectonucleoside triphosphate diphosphohydrolase-3 antibody targets adult human pancreatic β cells for in vitro and in vivo analysis. Cell Metab. 2019;29(3):745–754.
    View this article via: CrossRef PubMed Google Scholar
  27. DiGruccio MR, et al. Comprehensive alpha, beta and delta cell transcriptomes reveal that ghrelin selectively activates delta cells and promotes somatostatin release from pancreatic islets. Mol Metab. 2016;5(7):449–458.
    View this article via: CrossRef PubMed Google Scholar
  28. Tarifeno-Saldivia E, et al. Transcriptome analysis of pancreatic cells across distant species highlights novel important regulator genes. BMC Biol. 2017;15(1):21.
    View this article via: CrossRef PubMed Google Scholar
  29. Chen J, et al. The trans-ancestral genomic architecture of glycemic traits. Nat Genet. 2021;53(6):840–860.
    View this article via: CrossRef PubMed Google Scholar
  30. Pasquali L, et al. Pancreatic islet enhancer clusters enriched in type 2 diabetes risk-associated variants. Nat Genet. 2014;46(2):136–143.
    View this article via: CrossRef PubMed Google Scholar
  31. Miguel-Escalada I, et al. Human pancreatic islet three-dimensional chromatin architecture provides insights into the genetics of type 2 diabetes. Nat Genet. 2019;51(7):1137–1148.
    View this article via: CrossRef PubMed Google Scholar
  32. Lee CS, et al. Foxa2 is required for the differentiation of pancreatic alpha-cells. Dev Biol. 2005;278(2):484–495.
    View this article via: CrossRef PubMed Google Scholar
  33. Conrad E, et al. The MAFB transcription factor impacts islet α-cell function in rodents and represents a unique signature of primate islet β-cells. Am J Physiol Endocrinol Metab. 2016;310(1):E91–E102.
    View this article via: CrossRef PubMed Google Scholar
  34. Artner I, et al. MafB: an activator of the glucagon gene expressed in developing islet alpha- and beta-cells. Diabetes. 2006;55(2):297–304.
    View this article via: CrossRef PubMed Google Scholar
  35. Katoh MC, et al. MafB is critical for glucagon production and secretion in mouse pancreatic α cells in vivo. Mol Cell Biol. 2018;38(8):e00504-17.
    View this article via: CrossRef PubMed Google Scholar
  36. Singh K, et al. The L-arginine transporter solute carrier family 7 member 2 mediates the immunopathogenesis of attaching and effacing bacteria. PLoS Pathog. 2016;12(10):e1005984.
    View this article via: CrossRef PubMed Google Scholar
  37. Blachier F, et al. Stimulus-secretion coupling of arginine-induced insulin release. Functional response of islets to L-arginine and L-ornithine. Biochim Biophys Acta. 1989;1013(2):144–151.
    View this article via: CrossRef PubMed Google Scholar
  38. Lawlor N, et al. Single-cell transcriptomes identify human islet cell signatures and reveal cell-type-specific expression changes in type 2 diabetes. Genome Res. 2017;27(2):208–222.
    View this article via: CrossRef PubMed Google Scholar
  39. Blachier F, et al. Stimulus-secretion coupling of arginine-induced insulin release. Uptake of metabolized and nonmetabolized cationic amino acids by pancreatic islets. Endocrinology. 1989;124(1):134–141.
    View this article via: CrossRef PubMed Google Scholar
  40. Capozzi ME, et al. β Cell tone is defined by proglucagon peptides through cAMP signaling. JCI Insight. 2019;4(5):e126742.
    View this article via: JCI Insight CrossRef PubMed Google Scholar
  41. Svendsen B, et al. Insulin secretion depends on intra-islet glucagon signaling. Cell Rep. 2018;25(5):1127–1134.
    View this article via: CrossRef PubMed Google Scholar
  42. Yudkin JS, et al. Unexplained variability of glycated haemoglobin in non-diabetic subjects not related to glycaemia. Diabetologia. 1990;33(4):208–215.
    View this article via: CrossRef PubMed Google Scholar
  43. Fang Z, et al. Single-cell heterogeneity analysis and CRISPR screen identify key β-cell-specific disease genes. Cell Rep. 2019;26(11):3132–3144.
    View this article via: CrossRef PubMed Google Scholar
  44. Shrestha S, et al. Combinatorial transcription factor profiles predict mature and functional human islet α and β cells. JCI Insight. 2021;6(18):e151621.
    View this article via: JCI Insight CrossRef PubMed Google Scholar
  45. Bosi E, et al. Human alpha cell transcriptomic signatures of types 1 and 2 diabetes highlight disease-specific dysfunction pathways. iScience. 2022;25(10):105056.
    View this article via: CrossRef PubMed Google Scholar
  46. Keller MP, et al. Genetic drivers of pancreatic islet function. Genetics. 2018;209(1):335–356.
    View this article via: CrossRef PubMed Google Scholar
  47. Coate KC, et al. Interruption of glucagon signaling augments islet non-alpha cell proliferation in SLC7A2- and mTOR-dependent manners. Mol Metab. 2024;90:102050.
    View this article via: CrossRef PubMed Google Scholar
  48. Roux PP, et al. RAS/ERK signaling promotes site-specific ribosomal protein S6 phosphorylation via RSK and stimulates cap-dependent translation. J Biol Chem. 2007;282(19):14056–14064.
    View this article via: CrossRef PubMed Google Scholar
  49. Gong Y, et al. Hyperaminoacidemia induces pancreatic α cell proliferation via synergism between the mTORC1 and CaSR-Gq signaling pathways. Nat Commun. 2023;14(1):235.
    View this article via: CrossRef PubMed Google Scholar
  50. Kang Q, et al. ErbB3 is required for hyperaminoacidemia-induced pancreatic α cell hyperplasia. J Biol Chem. 2024;300(8):107499.
    View this article via: CrossRef PubMed Google Scholar
  51. Jia J, et al. Blockade of glucagon receptor induces α-cell hypersecretion by hyperaminoacidemia in mice. Nat Commun. 2025;16(1):2473.
    View this article via: CrossRef PubMed Google Scholar
  52. Takahara T, et al. Amino acid-dependent control of mTORC1 signaling: a variety of regulatory modes. J Biomed Sci. 2020;27(1):87.
    View this article via: CrossRef PubMed Google Scholar
  53. Coburn LA, et al. Loss of solute carrier family 7 member 2 exacerbates inflammation-associated colon tumorigenesis. Oncogene. 2019;38(7):1067–1079.
    View this article via: CrossRef PubMed Google Scholar
  54. Sun T, et al. SLC7A2 serves as a potential biomarker and therapeutic target for ovarian cancer. Aging (Albany NY). 2020;12(13):13281–13296.
    View this article via: CrossRef PubMed Google Scholar
  55. Xia S, et al. SLC7A2 deficiency promotes hepatocellular carcinoma progression by enhancing recruitment of myeloid-derived suppressors cells. Cell Death Dis. 2021;12(6):570.
    View this article via: CrossRef PubMed Google Scholar
  56. Rodriguez-Ruiz ME, et al. Apoptotic caspases inhibit abscopal responses to radiation and identify a new prognostic biomarker for breast cancer patients. Oncoimmunology. 2019;8(11):e1655964.
    View this article via: CrossRef PubMed Google Scholar
  57. Dean ED. A primary role for α-cells as amino acid sensors. Diabetes. 2020;69(4):542–549.
    View this article via: CrossRef PubMed Google Scholar
  58. Furuyama K, et al. Diabetes relief in mice by glucose-sensing insulin-secreting human α-cells. Nature. 2019;567(7746):43–48.
    View this article via: CrossRef PubMed Google Scholar
  59. Jun LS, et al. Absence of glucagon and insulin action reveals a role for the GLP-1 receptor in endogenous glucose production. Diabetes. 2015;64(3):819–827.
    View this article via: CrossRef PubMed Google Scholar
  60. Brissova M, et al. Islet microenvironment, modulated by vascular endothelial growth factor-A signaling, promotes β cell regeneration. Cell Metab. 2014;19(3):498–511.
    View this article via: CrossRef PubMed Google Scholar
  61. Golson ML, et al. Automated quantification of pancreatic β-cell mass. Am J Physiol Endocrinol Metab. 2014;306(12):E1460–E1467.
    View this article via: CrossRef PubMed Google Scholar
  62. Kayton NS, et al. Human islet preparations distributed for research exhibit a variety of insulin-secretory profiles. Am J Physiol Endocrinol Metab. 2015;308(7):E592–E602.
    View this article via: CrossRef PubMed Google Scholar
Version history
  • Version 1 (June 15, 2026): Electronic publication

Article tools

  • View PDF
  • Download citation information
  • Send a comment
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal

Metrics

  • Article usage
  • Citations to this article

Go to

  • Top
  • Abstract
  • Introduction
  • Results
  • Discussion
  • Methods
  • Author contributions
  • Conflict of interest
  • Funding support
  • Supplemental material
  • Acknowledgments
  • Footnotes
  • References
  • Version history
Advertisement
Advertisement

Copyright © 2026 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)

Sign up for email alerts