Mutational inactivation of the mouse Kvlqt1 gene. (a) Mouse Kvlqt1 genomic locus and knockout construct. Top: restriction map of exons 1 and 2; middle: 6-kb EcoRV-EcoRI fragment subcloned into pBluescript. The open box denotes the insertion of the neo gene in exon 1. The neo cassette was inserted after A₃₄₅ as marked by the arrow in the following sequence: CCACTATTGA↓GCAGTATGCC. The nucleotide sequences are based on U70068. The KvLQT1 is translated from the nucleotide 104. The exon 1 is shared by all isoforms, so targeting at exon 1 inactivates all KvLQT1 isoforms. The detailed description of isoforms and their organization can be found in ref. 5. The dashed lines mark the targeted region for homologous recombination. Bottom: restriction map of the Kvlqt1 locus after recombination. A diagnostic Pvu II site generates a mutant-specific 3.9-kb fragment using the probe indicated, in contrast to a 4.2-kb Pvu II fragment in the wild-type mouse locus. (b) Genotyping of transgenic mice. Genomic DNA was digested with Pvu II and hybridized with the probe shown in a. The +/+ indicates wild-type as demonstrated by a single 4.2-kb Pvu II fragment, +/– indicates heterozygous mice as demonstrated by the presence of both 4.2- and 3.9-kb fragments, and –/– indicates homozygous mutant as demonstrated by a single 3.9-kb mutant Pvu II fragment. This is also consistent with typing by PCR (data not shown) and phenotype. (c) Presence or absence of KvLQT1 expression in wild-type and mutant mice, as measured by RT-PCR using primers spanning an intron-exon boundary. The forward primer, mLQT111 (GTGTTTCGTGTACCACTTCACCGTCTT), in exon 1a and exon 1 (across the junction) is upstream to the neo insertion site, and reverse primer, mLQT211 (TACCATTGGCTACGGGGATAAGGTACC) in exon 6 is downstream to the neo insertion site. The presence of a 1.6-kb insertion in homozygous mutant mice prevents the efficient amplification in RT-PCR reaction.