Go to JCI Insight
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Alerts
  • Advertising/recruitment
  • Subscribe
  • Contact
  • Current Issue
  • Past Issues
  • By specialty
    • COVID-19
    • Cardiology
    • Gastroenterology
    • Immunology
    • Metabolism
    • Nephrology
    • Neuroscience
    • Oncology
    • Pulmonology
    • Vascular biology
    • All ...
  • Videos
    • Conversations with Giants in Medicine
    • Author's Takes
  • Reviews
    • View all reviews ...
    • 100th Anniversary of Insulin's Discovery (Jan 2021)
    • Hypoxia-inducible factors in disease pathophysiology and therapeutics (Oct 2020)
    • Latency in Infectious Disease (Jul 2020)
    • Immunotherapy in Hematological Cancers (Apr 2020)
    • Big Data's Future in Medicine (Feb 2020)
    • Mechanisms Underlying the Metabolic Syndrome (Oct 2019)
    • Reparative Immunology (Jul 2019)
    • View all review series ...
  • Viewpoint
  • Collections
    • Recently published
    • In-Press Preview
    • Commentaries
    • Concise Communication
    • Editorials
    • Viewpoint
    • Top read articles
  • Clinical Medicine
  • JCI This Month
    • Current issue
    • Past issues

  • Current issue
  • Past issues
  • Specialties
  • Reviews
  • Review series
  • Conversations with Giants in Medicine
  • Author's Takes
  • Recently published
  • In-Press Preview
  • Commentaries
  • Concise Communication
  • Editorials
  • Viewpoint
  • Top read articles
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Alerts
  • Advertising/recruitment
  • Subscribe
  • Contact
Top
  • View PDF
  • Download citation information
  • Send a letter
  • Share this article
  • Terms of use
  • Standard abbreviations
  • Need Help? E-mail the JCI
  • Top
  • Footnotes
  • References
  • Version history
  • Article usage
  • Citations to this article

Advertisement

Corrigendum Free access | 10.1172/JCI96729

Isolated polycystic liver disease genes define effectors of polycystin-1 function

Whitney Besse, Ke Dong, Jungmin Choi, Sohan Punia, Sorin V. Fedeles, Murim Choi, Anna-Rachel Gallagher, Emily B. Huang, Ashima Gulati, James Knight, Shrikant Mane, Esa Tahvanainen, Pia Tahvanainen, Simone Sanna-Cherchi, Richard P. Lifton, Terry Watnick, York P. Pei, Vicente E. Torres, and Stefan Somlo

Find articles by Besse, W. in: JCI | PubMed | Google Scholar

Find articles by Dong, K. in: JCI | PubMed | Google Scholar

Find articles by Choi, J. in: JCI | PubMed | Google Scholar

Find articles by Punia, S. in: JCI | PubMed | Google Scholar

Find articles by Fedeles, S. in: JCI | PubMed | Google Scholar

Find articles by Choi, M. in: JCI | PubMed | Google Scholar

Find articles by Gallagher, A. in: JCI | PubMed | Google Scholar

Find articles by Huang, E. in: JCI | PubMed | Google Scholar

Find articles by Gulati, A. in: JCI | PubMed | Google Scholar

Find articles by Knight, J. in: JCI | PubMed | Google Scholar

Find articles by Mane, S. in: JCI | PubMed | Google Scholar

Find articles by Tahvanainen, E. in: JCI | PubMed | Google Scholar

Find articles by Tahvanainen, P. in: JCI | PubMed | Google Scholar

Find articles by Sanna-Cherchi, S. in: JCI | PubMed | Google Scholar

Find articles by Lifton, R. in: JCI | PubMed | Google Scholar

Find articles by Watnick, T. in: JCI | PubMed | Google Scholar

Find articles by Pei, Y. in: JCI | PubMed | Google Scholar

Find articles by Torres, V. in: JCI | PubMed | Google Scholar

Find articles by Somlo, S. in: JCI | PubMed | Google Scholar

Published September 1, 2017 - More info

Published in Volume 127, Issue 9 on September 1, 2017
J Clin Invest. 2017;127(9):3558–3558. https://doi.org/10.1172/JCI96729.
Copyright © 2017, American Society for Clinical Investigation
Published September 1, 2017 - Version history
View PDF

Related article:

Isolated polycystic liver disease genes define effectors of polycystin-1 function
Whitney Besse, … , Vicente E. Torres, Stefan Somlo
Whitney Besse, … , Vicente E. Torres, Stefan Somlo
Research Article Genetics Nephrology

Isolated polycystic liver disease genes define effectors of polycystin-1 function

  • Text
  • PDF
Abstract

Dominantly inherited isolated polycystic liver disease (PCLD) consists of liver cysts that are radiologically and pathologically identical to those seen in autosomal dominant polycystic kidney disease, but without clinically relevant kidney cysts. The causative genes are known for fewer than 40% of PCLD index cases. Here, we have used whole exome sequencing in a discovery cohort of 102 unrelated patients who were excluded for mutations in the 2 most common PCLD genes, PRKCSH and SEC63, to identify heterozygous loss-of-function mutations in 3 additional genes, ALG8, GANAB, and SEC61B. Similarly to PRKCSH and SEC63, these genes encode proteins that are integral to the protein biogenesis pathway in the endoplasmic reticulum. We inactivated these candidate genes in cell line models to show that loss of function of each results in defective maturation and trafficking of polycystin-1, the central determinant of cyst pathogenesis. Despite acting in a common pathway, each PCLD gene product demonstrated distinct effects on polycystin-1 biogenesis. We also found enrichment on a genome-wide basis of heterozygous mutations in the autosomal recessive polycystic kidney disease gene PKHD1, indicating that adult PKHD1 carriers can present with clinical PCLD. These findings define genetic and biochemical modulators of polycystin-1 function and provide a more complete definition of the spectrum of dominant human polycystic diseases.

Authors

Whitney Besse, Ke Dong, Jungmin Choi, Sohan Punia, Sorin V. Fedeles, Murim Choi, Anna-Rachel Gallagher, Emily B. Huang, Ashima Gulati, James Knight, Shrikant Mane, Esa Tahvanainen, Pia Tahvanainen, Simone Sanna-Cherchi, Richard P. Lifton, Terry Watnick, York P. Pei, Vicente E. Torres, Stefan Somlo

×

Original citation: J Clin Invest. 2017;127(5):1772–1785. https://doi.org/10.1172/JCI90129

Citation for this corrigendum: J Clin Invest. 2017;127(9):3558. https://doi.org/10.1172/JCI96729

In the original article, the RT-PCR primer sequences listed in Methods were incorrectly labeled as Pkd1. The correct primer sequences for Pkd1 are in the revised paragraph below.

Quantitative PCR and reverse transcription PCR. RNA was isolated from cultured cells using Trizol Reagent (Invitrogen). cDNA was reverse transcribed from RNA using reagents from New England Biolabs. Primers for Pkd1 quantitative PCR (forward, GCTACAGGGCATCCTGGTG; reverse, GGCTGTCAGCGAGAGCTTGAA) were designed using NCBI’s primer-designing tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). Quantitative PCR was done by Bio-Rad CFX Connect Real-Time PCR Detection System. Primers for Xbp1 RT-PCR have been published previously (1).

The authors regret the error.

Footnotes

See the related article at Isolated polycystic liver disease genes define effectors of polycystin-1 function.

References
  1. Iwakoshi NN, Lee AH, Vallabhajosyula P, Otipoby KL, Rajewsky K, Glimcher LH. Plasma cell differentiation and the unfolded protein response intersect at the transcription factor XBP-1. Nat Immunol. 2003;4(4):321–329.
    View this article via: PubMed CrossRef Google Scholar
Version history
  • Version 1 (September 1, 2017): Print issue publication

Article tools

  • View PDF
  • Download citation information
  • Send a letter
  • Share this article
  • Terms of use
  • Standard abbreviations
  • Need Help? E-mail the JCI

Metrics

  • Article usage
  • Citations to this article

Go to

  • Top
  • Footnotes
  • References
  • Version history
Advertisement
Advertisement
Follow JCI:
Copyright © 2021 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)

Sign up for email alerts