Advertisement
A murine model of hereditary hemorrhagic telangiectasia
Annie Bourdeau,1 Daniel J. Dumont,2 and Michelle Letarte1
1Cancer and Blood Program, The Hospital for Sick Children and Department of Immunology, University of Toronto, Toronto, Ontario M5G 1X8, Canada2Division of Cancer Biology Research, Sunnybrook and Women’s College Health Sciences Center, and Department of Medical Biophysics, University of Toronto, Toronto, Ontario M4N 3M5, Canada
Address correspondence to: Michelle Letarte, Cancer and Blood Program, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada. Phone: (416) 813-6258; Fax: (416) 813-6255; E-mail: mablab@sickkids.on.ca.
Find articles by Bourdeau, A. in: JCI | PubMed | Google Scholar
1Cancer and Blood Program, The Hospital for Sick Children and Department of Immunology, University of Toronto, Toronto, Ontario M5G 1X8, Canada2Division of Cancer Biology Research, Sunnybrook and Women’s College Health Sciences Center, and Department of Medical Biophysics, University of Toronto, Toronto, Ontario M4N 3M5, Canada
Address correspondence to: Michelle Letarte, Cancer and Blood Program, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada. Phone: (416) 813-6258; Fax: (416) 813-6255; E-mail: mablab@sickkids.on.ca.
Find articles by Dumont, D. in: JCI | PubMed | Google Scholar
1Cancer and Blood Program, The Hospital for Sick Children and Department of Immunology, University of Toronto, Toronto, Ontario M5G 1X8, Canada2Division of Cancer Biology Research, Sunnybrook and Women’s College Health Sciences Center, and Department of Medical Biophysics, University of Toronto, Toronto, Ontario M4N 3M5, Canada
Address correspondence to: Michelle Letarte, Cancer and Blood Program, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada. Phone: (416) 813-6258; Fax: (416) 813-6255; E-mail: mablab@sickkids.on.ca.
Find articles by Letarte, M. in: JCI | PubMed | Google Scholar
Published November 15, 1999 - More info
J Clin Invest. 1999;104(10):1343–1351. https://doi.org/10.1172/JCI8088.
© 1999 The American Society for Clinical Investigation
Received: August 9, 1999; Accepted: September 22, 1999
-
Methods
Generation of End-deficient mice. A murine endoglin genomic clone of 14.8 kb was isolated from a 129 SVJ library by screening with the nonradioactive dioxigenin (DIG)-system (Boehringer-Mannheim, Montreal, Quebec, Canada) with a full-length and a 5′-end fragment (583 bp) of murine endoglin cDNA (12). The replacement targeting vector was engineered in 3 cloning steps and required the pSDKLacZ vector with a LacZ cassette and the pPNT vector with neomycin (Neo) and herpes simplex thymidine kinase (tk) cassettes for positive and negative selections. A 1426-bp SmaI endoglin fragment, containing the promoter area and terminating 8 bp upstream of the ATG, was used as 5′ homology region (5′ HR) and subcloned upstream of the LacZ cassette into the pSDKLacZ vector. A SmaI-BglII fragment (5100 bp of intron 1) was used as 3′ HR and ligated into the blunted XbaI (BamHI cohesive) site of the pPNT vector, upstream of the tk cassette. The 5′ HR and LacZ cassette were then inserted as a SalI fragment into the XhoI site, upstream of the Neo cassette in the pPNT vector. The LacZ and Neo genes thus replaced a region of 609 bp containing the End initiation codon.
The endoglin-targeting construct was linearized with NotI and electroporated into the 129/Ola-derived embryonic stem (ES) cell line E14. Colonies were subjected to positive and negative selections with G418 and ganciclovir (2 μM/mL) for 10 days. DNA was made from all resistant ES cell clones and digested with ScaI. Screening for proper recombination events was achieved by Southern blot analysis using a 32P-labeled 5′ external probe (614-bp SmaI fragment) and a 1000-bp EcoRI-SacI LacZ internal probe to confirm single integration events (Figure 1a). Positive ES cell clones were injected into C57BL/6 blastocysts yielding 4 fertile male chimeras, 2 of which gave germline transmission.
Figure 1Generation of End–/– mice. (a) Targeting strategy. Homologous recombination deletes 609 bp of the End gene including exon 1 (E1; 66 bp), placing the LacZ gene under control of its promoter. The targeting construct contains a 1.4-kb SmaI fragment (5′ HR) and a 5.1-kb SmaI-BglII fragment (3′ HR) of the End gene flanking the LacZ-Neo cassette. Proper recombination events were screened by Southern blot analysis with 5′ external and LacZ internal probes. Bm, BamHI; Bg, BglII; EI, EcoRI; Sa, SacI; Sc, ScaI; Sm, SmaI; Xb, XbaI. (b) Identification of targeted ES cell lines. DNA from 2 geneticin- and ganciclovir-resistant targeted ES cells (4A-11, 4A-36) and a wild-type clone (WT) were digested with ScaI. The 5.4-kb WT and 7.3-kb recombinant alleles hybridizing with the 5′ external probe and the recombinant allele reacting with the LacZ probe are shown. (c) Genotyping of embryos by multiplex PCR. DNA from yolk sacs of an E9.5 litter derived from a C57BL/6 End+/– mating is shown; #21 represents the mother and C represents the PCR control reaction without DNA. Primers ME1F and ME1R amplify normal exon 1 (300 bp), ME2F and ME2R amplify normal exon 2 (383 bp), and ME1F and MEZR specifically amplify the recombinant product (476 bp). (d) Absence of endoglin mRNA in End–/– embryos. RNA was prepared from the same embryos as in c and analyzed for endoglin and β-actin mRNA by RT-PCR.
The first generation (F1) of End+/– mice was produced by mating the chimeras with wild-type C57BL/6 females (Taconic Farms, Germantown, New York, USA). Eight F1 C57BL/6 End+/– males were crossed with wild-type or C57BL/6 End+/– females for 4 generations. These F1–F4 mice have a mixed genome of C57BL/6 and 129/Ola. The phenotype of End–/– embryos was analyzed on F1 and F2 intercrosses between C57BL/6 End+/– mice. F1 C57BL/6 End+/– were also crossed with wild-type CD1 mice (Harlan Sprague Dawley, Indianapolis, Indiana, USA). These mice, with a mixture of CD1, C57BL/6, and 129/Ola genes, were maintained by backcrosses with wild-type CD1 for 3 generations. End+/– mice have also been generated on an inbred 129/Ola background (same strain as ES cells) by mating of the chimeras with wild-type 129/Ola (Harlan UK, Bicester, United Kingdom) and subsequent backcrossing for 2 generations. All studies were approved by the Ontario Cancer Institute Animal Care Committee.
Genotyping of mice. The mid-day of plug observation was counted as E0.5. Embryos of equivalent stage and generally from the same litter were used for comparative analyses. Genotypes of embryos were determined using DNA isolated from the yolk sac or a small piece of embryonic tissue; for postnatal DNA, tails were used. A multiplex PCR was designed to amplify 3 sets of primers in a single reaction that can distinguish End+/+, End+/–, and End–/– alleles. All PCR reactions were run with initial denaturation for 2 minutes at 94°C, followed by 30 cycles at 94°C for 30 seconds, 56°C for 35 seconds, and 68°C for 2.5 minutes, with a final extension at 68°C for 5 minutes. Reactions contained 300 ng DNA, 400 μM dNTP, 2.5 mM magnesium chloride (MgCl2), 1 U AmpliTaq DNA Polymerase (Perkin Elmer, Roche Molecular Systems, Branchburg, New Jersey, USA), 40 pmol of primers ME1F and MEZR, and 20 pmol of the others. Selected primers, 5′→3′, were: ME1F (TACCTCTGGATACCGGATAAG), ME1R (AAGTTTGGCATCCTATGAAAC), MEZR (AAATGTGAGCGAGTAACAACC), ME2F (ATCTTACCCACTGAGCCATCT), and ME2R (CCCAGTCTACTCCGATTCTTA).
RT-PCR. RNA was extracted from E9.5 embryos using TRIzol Reagent (GIBCO BRL, Mississauga, Ontario, Canada), and 1 μg was used for cDNA synthesis using Superscript RT (GIBCO BRL). The cDNA was amplified for β-actin and endoglin using reported primers (12). PCR conditions were similar to those used above, except for 30 cycles of extension at 72°C for 30 seconds, and a final one of 5 minutes, using 1.5 mM MgCl2 and 200 μM dNTP.
Whole-mount β-galactosidase (β-gal) staining. Embryos or yolk sacs were dissected in PBS, fixed and stained as described (18), except for postfixation in 10% formaldehyde (Fisher Scientific Co., Nepean, Ontario, Canada). The embryos were paraffin embedded, sectioned (7–10 μm), and counterstained with 0.1% nuclear fast red (Fluka Chemica, Oakville, Ontario, Canada). Images were acquired with an Olympus BX50 microscope linked to a CCD video camera (Carsen Medical Scientific, Markham, Ontario, Canada) and digitized on a Power Macintosh G3 computer.
-
Results
Generation of endoglin null mice. A targeting construct was engineered to delete End exon 1 and its initiation codon, replacing it with the LacZ-Neo cassette (Figure 1a). Using Southern blot analysis, 8 heterozygous (End+/–) ES cell clones were identified, yielding a recombination frequency of 1/30. Results obtained for the 2 ES cell clones that gave germ-line transmission, 4A-11 and 4A-36, are illustrated in Figure 1b.
Embryos obtained from matings of C57BL/6 End+/– mice were genotyped by multiplex PCR. Results from typing of an E9.5 litter are shown in Figure 1c. Two End –/– endoglin embryos expressed the 476-bp fragment of the recombinant allele and the 383-bp fragment from normal exon 2. Three wild-type (End +/+) embryos showed the normal PCR products for exon 1 (300 bp) and exon 2 (383 bp). Four End+/– embryos and the End+/– mother (#21) showed all 3 PCR products.
To verify that the targeted mutation inactivated the gene, we examined expression of End mRNA in the embryos analyzed in Figure 1c. The 468-bp product corresponding to murine endoglin (exons 7–10) was present in the End+/– and End+/+ embryos, but absent from the 2 End–/– embryos. β-actin (550 bp) was expressed at equivalent levels in all embryos. Thus, no wild-type or truncated endoglin mRNA was detectable in End–/– mice (Figure 1d).
End–/– mice die in utero at E10–10.5. Expression of β-gal, under the control of the endoglin promoter in the targeting vector, recapitulated endogenous expression of endoglin in End+/– mice and facilitated the analysis of the End–/– phenotype in embryos. Examination of 103 E7.5–8.5 live embryos from C57BL/6 End+/– intercrosses revealed no obvious embryonic, placental, or yolk sac abnormalities and a normal 1:2:1 Mendelian ratio (Table 1). At E9.0, End+/– and End–/– embryos were of similar size, and their vasculature was revealed by the staining associated with endothelial cells. The heart of several End–/– embryos appeared enlarged (Figure 2). At E9.5 the End–/– embryos showed signs of growth retardation featured by a smaller head, underdeveloped nasal processes, and branchial arches. The heart was still beating but edematous pericardium was seen (Figure 2). At E9.0–9.5, 99 live embryos gave a normal Mendelian ratio. Of the 40 embryos analyzed at E10–10.5, only 7 were End–/–; 6 were dead with collapsed vasculature, edemic heart, and extensive tissue necrosis, and 1 showed irregular heart beats and extensive edema (Figure 2 and Table 1). From E11.5 to 15.5, no End–/– embryos were found among 30, confirming that deficiency in endoglin leads to embryonic lethality at E10–10.5 (Table 1). From a total of 136 born offspring, 33% were wild-type (End+/+), 67% were End+/–, and none were homozygous (End –/–), showing conclusively that the endoglin-null phenotype is lethal (Table 1).
Figure 2Arrest in development in End–/– embryos. β-gal expression driven by the End promoter was analyzed in whole End+/– and End–/– embryos. At E9.0, embryos are of similar size and their vasculature appears normal. The End–/– embryo shows an enlarged heart protruding forward (arrowhead). At E9.5, edematous pericardium (arrowhead) is observed in the End–/– embryo, which is growth-retarded compared with the End+/– embryo. At E10.5, the End –/– embryo is dead and is much smaller that the End+/– embryo. Bar: 500 μm.
Yolk sac defects in End–/– mice. The primitive vasculature of the End–/– embryos and the early vascular plexus of the yolk sac were normal until E9.0. This suggested a defect in yolk sac remodeling, essential for the interconnection of embryonic and extraembryonic circulatory systems. Yolk sacs of End–/– embryos at E9.0–9.5 revealed an abnormal vascular plexus. At E9.0, vascular channels were numerous, lined with an intact endothelium, and filled with normal levels of primitive erythroblasts (Figure 3, a and b). However, no branching occurred, in contrast to the End+/– yolk sac (Figure 3, c and d). At E9.5, vitelline vessels were completely absent from End–/– yolk sacs (Figure 3, e and f) and were replaced by enlarged and leaky channels that released their content into the yolk sac cavity (Figure 3, g and h). This hemorrhage was evident in unstained embryos, which showed blood accumulating in the yolk sac cavity between the amnion and the yolk sac membranes (Figure 3, i and j). We conclude that in the absence of endoglin, primitive vascular channels of the yolk sac did not form large vessels and were susceptible to rupture releasing hematopoietic precursors into the yolk sac cavity.
Figure 3Vascular defects in End–/– mice. Whole-mount embryos in their yolk sacs were stained for β-gal activity. (a, b, e, and f) Direct microscopic examination of the yolk sacs. (c, d, g, and h) Sagittal histological sections. At E9.0, the normal capillary plexus and initiation of branching are seen in the End+/– embryo (a and c). The End–/– yolk sac also has a highly vascularized plexus, but no vessel branching is observed (b and d). At E9.5, a vitelline vessel (v) is readily detectable in the End+/– yolk sac (e); this intact vessel is full of primitive red cells (g). The End–/– yolk sac shows a disorganized capillary plexus and no vitelline vessels (f); abnormally dilated blood islands are seen (h), which have ruptured, releasing primitive erythroblasts toward the amnion (arrowhead). (i and j) Unstained E9.5 embryos, with yolk sac and placenta still attached. Bleeding in the yolk sac cavity (arrowhead) and edematous pericardium (arrow) are observed in End–/– embryo (j), compared with a littermate control (i). An unstained E9.0 End+/– embryo (k), dissected away from the yolk sac, is compared with an End–/– littermate (l), which shows internal bleeding (arrow). Sagittal sections stained for β-gal demonstrate the presence of blood (arrow) in the peritoneal cavity of the End–/– embryo (n), which is absent from the End+/– embryo (m). a, dorsal aorta; pc, peritoneal cavity; u, umbilical vein. Bar: 100 μm (a–h), 500 μm (i and j), 250 μm (k–n).
Internal hemorrhage and abnormal heart development in End–/– embryos. Direct microscopic examination of unstained whole embryos dissected away from the yolk sac at E9.0 revealed internal hemorrhages in End–/– embryos (Figure 3, k and l), suggesting that vascular defects were not limited to the extraembryonic vasculature. Histological sections of End–/– embryos showed blood accumulating in the peritoneal cavity indicating that endothelium integrity was compromised. The dorsal aorta or the observed dilated umbilical vein could be the source of the extravasated blood (Figure 3, m and n). Thus, in the absence of endoglin, embryonic vessels are more fragile and susceptible to rupture.
End–/– embryos harvested at E9.0–10.5 had enlarged hearts and showed edematous pericardium when compared with their End+/– littermates (Figure 2). Sagittal sections revealed major differences in heart development. Normal End+/– embryos showed signs of a progressively developing endocardium, such as increasing trabeculation and closure of the atrioventricular canal (Figure 4). Endoglin expression, determined by β-gal activity, was also observed on cells undergoing endocardial-mesenchymal transformation and on the migrating mesenchymal cells that later form the atrioventricular cushion tissue (Figure 4). In contrast, the End–/– embryos manifested defects in heart development from E9.0. The endocardium remained rudimentary in the primitive ventricle, whose lumen failed to close in the atrioventricular area. At E9.0, some embryos revealed an abnormally dilated endocardium in the common atrial chamber and the bulbus cordis (Figure 4). No mesenchymal cells were detected in the heart of the End–/– embryos analyzed, indicating that endocardial-mesenchymal transformation, which leads to valve formation and heart septation, did not occur. At E10.5, the heart of the End–/– embryos was arrested, no longer beating, and with extensive necrosis.
Figure 4Heart deficiency in End–/– mice. Transverse sections from whole-mount embryos stained for β-gal activity are shown. The E9.0 End+/– embryo shows staining associated with the endocardium in the ventricular compartment (v) and tightly delineated in the atrioventricular region (av). The endocardium of the End–/– embryo is rudimentary, with an abnormally large lumen in the common atrial chamber (a) and the bulbus cordis (b). At E9.5 increased trabeculation is observed in the ventricle of the End+/– embryo; a few β-gal–stained mesenchymal cells (arrowhead) are seen adjacent to the atrioventricular canal. The heart of the End–/– embryo is much larger than that of the control and is devoid of trabeculae; mesenchymal cells are absent. At E10.5 cushion-tissue mesenchyme (arrowhead) from the End+/– embryo stains strongly positive for β-gal; in contrast, the heart of the End–/– embryo shows edema and signs of necrosis. Bar: 100 μm.
End+/– mice develop clinical signs of HHT. Four generations of C57BL/6 End+/– mice (a total of 227) were examined over a period of 1 to 12 months for clinical manifestations of HHT. Sick animals were first recognized by ruffled fur, weight loss, and visible ear telangiectases. We observed 14 affected End+/– mice, 13 of the 20 with a light coat color and only 1 of the 207 with a dark coat color (Table 2). Some animals also had neck and tail telangiectases and bled from the nose or mouth, once or twice a week (Table 2). Two mice died with extensive disease manifestations such as difficulty in breathing and internal hemorrhage. These C57BL/6 End+/– mice (F2–F4) still have a mixed genetic background with 129/Ola, from which the light coat color is derived. To determine if the 129/Ola strain was associated with the disease phenotype, we generated End+/– mice on this inbred background. We also bred the mixed C57BL/6-129/Ola F1 to CD1 mice, also of light coat color.
None of the 51 End+/– CD1 mice showed signs of disease when observed over 3–9 months. However, 5 out of 10 End+/– inbred 129/Ola mice showed visible telangiectases on the ears and 3 had nosebleeds, when observed over a period of 7 months (Table 2). Male 55.5 had its first nosebleed at 7 weeks and thereafter at a frequency of 2–3 times per week. Dried blood was noticeable around the nose after each bleed (Figure 5). At the end of a bleeding episode spanning 18–24 hours, the hematocrit value was dramatically reduced relative to control mice (45 vs. 67), but was returned to normal 4 days later. Female 69.1 had nosebleeds at least once a week, starting at 10 weeks (Table 2). Its hematocrit measured on a day with epistaxis was comparable to that of a female control mouse (55 vs. 52). Hematocrit values were normal for 20 dark–coat color C57BL/6 End+/– male (58-70) and female (49-63) mice tested.
Figure 5End+/– 129/Ola mice have nosebleeds and telangiectases characteristic of HHT. (a) A 129/Ola End+/– male mouse with recurrent nosebleeds and telangiectases is shown on the right of a female littermate with no disease manifestation. (b) Telangiectases are present on the upper part of both ears. (c) A side view provides a closer look at the affected nasal area.
An ear telangiectasia in the 129/Ola End+/–affected male 55.5 is shown in Figure 5. Direct microscopic examination of ear biopsies showed large dilated vessels at the periphery of the ear lobe, not seen in the normal control mice (Figure 6, a and b). These small vascular lesions generally lasted for 2–3 days and then ruptured and bled, often leading to partial ear necrosis. The β-gal–stained sections revealed the presence of abnormally dilated vessels, much larger than the capillaries seen normally in the ear (Figure 6, c and d). One such dilated vessel corresponding to a telangiectasia is shown at higher magnification along with several normal capillaries (Figure 6e). Female 102.6, progeny of male 55.5, showed several tail telangiectases and tail bleeding, frequent nosebleeds, and slower development, and died at 7 weeks.
Figure 6Microscopic examination of a telangiectasia from a 129/Ola End+/– mouse. Ear lobe biopsies from an End+/– mouse and normal littermate were left unstained (a and b) or were stained for β-gal activity (c and d). (a) A dilated vessel (arrow), engorged with blood, is seen in the affected End+/– ear lobe, together with a necrotic area (arrowhead) from a telangiectasia ruptured previously. (b) The corresponding area from a nonaffected control 129/Ola mouse shows much smaller vessels. (c) A small telangiectasia (arrow), close to the edge of the affected ear, appears as a dilated vessel distinct from the adjacent network of capillaries. (d) Normal capillary network from a nonaffected ear. (e) A cross-section of the resected ear segment from the affected 129/Ola End+/– mouse was stained for β-gal. An enlarged vessel filled with blood (arrow), corresponding to a telangiectasia, is seen. The endothelial cells of this vessel and of several normal small capillaries are stained; a layer of cartilage (ca) is seen across the section. Bar: 500 μm (a–d) and 100 μm (e).
Copyright © 2023 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)