Go to JCI Insight
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
  • Clinical Research and Public Health
  • Current issue
  • Past issues
  • By specialty
    • COVID-19
    • Cardiology
    • Gastroenterology
    • Immunology
    • Metabolism
    • Nephrology
    • Neuroscience
    • Oncology
    • Pulmonology
    • Vascular biology
    • All ...
  • Videos
    • ASCI Milestone Awards
    • Video Abstracts
    • Conversations with Giants in Medicine
  • Reviews
    • View all reviews ...
    • Clinical innovation and scientific progress in GLP-1 medicine (Nov 2025)
    • Pancreatic Cancer (Jul 2025)
    • Complement Biology and Therapeutics (May 2025)
    • Evolving insights into MASLD and MASH pathogenesis and treatment (Apr 2025)
    • Microbiome in Health and Disease (Feb 2025)
    • Substance Use Disorders (Oct 2024)
    • Clonal Hematopoiesis (Oct 2024)
    • View all review series ...
  • Viewpoint
  • Collections
    • In-Press Preview
    • Clinical Research and Public Health
    • Research Letters
    • Letters to the Editor
    • Editorials
    • Commentaries
    • Editor's notes
    • Reviews
    • Viewpoints
    • 100th anniversary
    • Top read articles

  • Current issue
  • Past issues
  • Specialties
  • Reviews
  • Review series
  • ASCI Milestone Awards
  • Video Abstracts
  • Conversations with Giants in Medicine
  • In-Press Preview
  • Clinical Research and Public Health
  • Research Letters
  • Letters to the Editor
  • Editorials
  • Commentaries
  • Editor's notes
  • Reviews
  • Viewpoints
  • 100th anniversary
  • Top read articles
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
Top
  • View PDF
  • Download citation information
  • Send a comment
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal
  • Top
  • Version history
  • Article usage
  • Citations to this article

Advertisement

CorrigendumAging Free access | 10.1172/JCI15681C1

Cyclooxygenase-2 regulates mesenchymal cell differentiation into the osteoblast lineage and is critically involved in bone repair

Xinping Zhang, Edward M. Schwarz, Donald A. Young, J. Edward Puzas, Randy N. Rosier, and Regis J. O’Keefe

Find articles by Zhang, X. in: PubMed | Google Scholar

Find articles by Schwarz, E. in: PubMed | Google Scholar

Find articles by Young, D. in: PubMed | Google Scholar

Find articles by Puzas, J. in: PubMed | Google Scholar

Find articles by Rosier, R. in: PubMed | Google Scholar

Find articles by O’Keefe, R. in: PubMed | Google Scholar

Published October 15, 2002 - More info

Published in Volume 110, Issue 8 on October 15, 2002
J Clin Invest. 2002;110(8):1211–1211. https://doi.org/10.1172/JCI15681C1.
© 2002 The American Society for Clinical Investigation
Published October 15, 2002 - Version history
View PDF

Related article:

Cyclooxygenase-2 regulates mesenchymal cell differentiation into the osteoblast lineage and is critically involved in bone repair
Xinping Zhang, Edward M. Schwarz, Donald A. Young, J. Edward Puzas, Randy N. Rosier, Regis J. O’Keefe
Xinping Zhang, Edward M. Schwarz, Donald A. Young, J. Edward Puzas, Randy N. Rosier, Regis J. O’Keefe
Article Aging

Cyclooxygenase-2 regulates mesenchymal cell differentiation into the osteoblast lineage and is critically involved in bone repair

  • Text
  • PDF
Abstract

Preclinical and clinical studies suggest a possible role for cyclooxygenases in bone repair and create concerns about the use of nonsteroidal antiinflammatory drugs in patients with skeletal injury. We utilized wild-type, COX-1–/–, and COX-2–/– mice to demonstrate that COX-2 plays an essential role in both endochondral and intramembranous bone formation during skeletal repair. The healing of stabilized tibia fractures was significantly delayed in COX-2–/– mice compared with COX-1–/– and wild-type controls. The histology was characterized by a persistence of undifferentiated mesenchyme and a marked reduction in osteoblastogenesis that resulted in a high incidence of fibrous nonunion in the COX-2–/– mice. Similarly, intramembranous bone formation on the calvaria was reduced 60% in COX-2–/– mice following in vivo injection of FGF-1 compared with either COX-1–/– or wild-type mice. To elucidate the mechanism involved in reduced bone formation, osteoblastogenesis was studied in bone marrow stromal cell cultures obtained from COX-2–/– and wild-type mice. Bone nodule formation was reduced 50% in COX-2–/– mice. The defect in osteogenesis was completely rescued by addition of prostaglandin E2 (PGE2) to the cultures. In the presence of bone morphogenetic protein (BMP-2), bone nodule formation was enhanced to a similar level above that observed with PGE2 alone in both control and COX-2–/– cultures, indicating that BMPs complement COX-2 deficiency and are downstream of prostaglandins. Furthermore, we found that the defect in COX-2–/– cultures correlated with significantly reduced levels of cbfa1 and osterix, two genes necessary for bone formation. Addition of PGE2 rescued this defect, while BMP-2 enhanced cbfa1 and osterix in both COX-2–/– and wild-type cultures. Finally, the effects of these agents were additive, indicating that COX-2 is involved in maximal induction of osteogenesis. These results provide a model whereby COX-2 regulates the induction of cbfa1 and osterix to mediate normal skeletal repair.

Authors

Xinping Zhang, Edward M. Schwarz, Donald A. Young, J. Edward Puzas, Randy N. Rosier, Regis J. O’Keefe

×

Original citation: J. Clin. Invest.109:1405–1415 (2002). doi:10.1172/JCI15681

Citation for this corrigendum: J. Clin. Invest.109:1211 (2002). doi:10.1172/JCI15681C1

The authors would like to correct an error in the Methods section. The primer sequences used to amplify cbfa1 in the PCR reaction were TGGCAGCACGCTATTAAATC (forward) and TCTGCCGCTAGAATTCAAAA (reverse), instead of the primers listed in the published article.

Version history
  • Version 1 (October 15, 2002): No description

Article tools

  • View PDF
  • Download citation information
  • Send a comment
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal

Metrics

  • Article usage
  • Citations to this article

Go to

  • Top
  • Version history
Advertisement
Advertisement

Copyright © 2026 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)

Sign up for email alerts