Go to JCI Insight
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Alerts
  • Advertising
  • Job board
  • Subscribe
  • Contact
  • Current issue
  • Past issues
  • By specialty
    • COVID-19
    • Cardiology
    • Gastroenterology
    • Immunology
    • Metabolism
    • Nephrology
    • Neuroscience
    • Oncology
    • Pulmonology
    • Vascular biology
    • All ...
  • Videos
    • Conversations with Giants in Medicine
    • Author's Takes
  • Reviews
    • View all reviews ...
    • Immune Environment in Glioblastoma (Feb 2023)
    • Korsmeyer Award 25th Anniversary Collection (Jan 2023)
    • Aging (Jul 2022)
    • Next-Generation Sequencing in Medicine (Jun 2022)
    • New Therapeutic Targets in Cardiovascular Diseases (Mar 2022)
    • Immunometabolism (Jan 2022)
    • Circadian Rhythm (Oct 2021)
    • View all review series ...
  • Viewpoint
  • Collections
    • In-Press Preview
    • Commentaries
    • Research letters
    • Letters to the editor
    • Editor's notes
    • Editorials
    • Viewpoint
    • Top read articles
  • Clinical Medicine
  • JCI This Month
    • Current issue
    • Past issues

  • Current issue
  • Past issues
  • Specialties
  • Reviews
  • Review series
  • Conversations with Giants in Medicine
  • Author's Takes
  • In-Press Preview
  • Commentaries
  • Research letters
  • Letters to the editor
  • Editorials
  • Viewpoint
  • Top read articles
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Alerts
  • Advertising
  • Job board
  • Subscribe
  • Contact
Top
  • View PDF
  • Download citation information
  • Send a comment
  • Share this article
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal
  • Top
  • Abstract
  • Introduction
  • Methods
  • Results
  • Discussion
  • Acknowledgments
  • Footnotes
  • References
  • Version history
  • Article usage
  • Citations to this article

Advertisement

Article Free access | 10.1172/JCI13505

Role of AMP-activated protein kinase in mechanism of metformin action

Gaochao Zhou,1 Robert Myers,1 Ying Li,1 Yuli Chen,1 Xiaolan Shen,1 Judy Fenyk-Melody,1 Margaret Wu,1 John Ventre,1 Thomas Doebber,1 Nobuharu Fujii,2 Nicolas Musi,2 Michael F. Hirshman,2 Laurie J. Goodyear,2 and David E. Moller1

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Zhou, G. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Myers, R. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Li, Y. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Chen, Y. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Shen, X. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Fenyk-Melody, J. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Wu, M. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Ventre, J. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Doebber, T. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Fujii, N. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Musi, N. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Hirshman, M. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Goodyear, L. in: JCI | PubMed | Google Scholar

1Departments of Molecular Endocrinology, Metabolic Disorders, and Comparative Medicine, Merck Research Laboratories, Rahway, New Jersey, USA2Joslin Diabetes Center and Harvard Medical School, Boston, Massachusetts, USA

Address correspondence to: Gaochao Zhou, Merck Research Laboratories, Rahway, New Jersey 07065, USA. Phone: (732) 594-4782; Fax: (732) 594-5700; E-mail: gaochao_zhou@merck.com.

Find articles by Moller, D. in: JCI | PubMed | Google Scholar

Published October 15, 2001 - More info

Published in Volume 108, Issue 8 on October 15, 2001
J Clin Invest. 2001;108(8):1167–1174. https://doi.org/10.1172/JCI13505.
© 2001 The American Society for Clinical Investigation
Published October 15, 2001 - Version history
Received: June 13, 2001; Accepted: August 28, 2001
View PDF
Abstract

Metformin is a widely used drug for treatment of type 2 diabetes with no defined cellular mechanism of action. Its glucose-lowering effect results from decreased hepatic glucose production and increased glucose utilization. Metformin’s beneficial effects on circulating lipids have been linked to reduced fatty liver. AMP-activated protein kinase (AMPK) is a major cellular regulator of lipid and glucose metabolism. Here we report that metformin activates AMPK in hepatocytes; as a result, acetyl-CoA carboxylase (ACC) activity is reduced, fatty acid oxidation is induced, and expression of lipogenic enzymes is suppressed. Activation of AMPK by metformin or an adenosine analogue suppresses expression of SREBP-1, a key lipogenic transcription factor. In metformin-treated rats, hepatic expression of SREBP-1 (and other lipogenic) mRNAs and protein is reduced; activity of the AMPK target, ACC, is also reduced. Using a novel AMPK inhibitor, we find that AMPK activation is required for metformin’s inhibitory effect on glucose production by hepatocytes. In isolated rat skeletal muscles, metformin stimulates glucose uptake coincident with AMPK activation. Activation of AMPK provides a unified explanation for the pleiotropic beneficial effects of this drug; these results also suggest that alternative means of modulating AMPK should be useful for the treatment of metabolic disorders.

Introduction

Metformin is widely used for the therapy of type 2 diabetes mellitus (DM2) (1). Metformin ameliorates hyperglycemia without stimulating insulin secretion, promoting weight gain, or causing hypoglycemia (2, 3). In addition, metformin has beneficial effects on circulating lipids linked to increased cardiovascular risk (2–4).

Although used as a drug since 1957, the mechanism(s) by which metformin lowers glucose and lipids remains an enigma. Two effects, decreased hepatic glucose production (2, 5, 6) and increased skeletal myocyte glucose uptake (7, 8), have been implicated as major contributors to glucose-lowering efficacy. Metformin also decreases hepatic lipids in obese mice (9). Metformin is, however, a low-potency compound that is used at high doses, resulting in only modest net efficacy; in addition, significant side effects can occur (2). Thus, an understanding of the molecular basis for metformin’s effects on glucose and lipid homeostasis is a critical focus of research directed toward improved therapeutic approaches to DM2 and related disorders.

AMP-activated protein kinase (AMPK) provides a candidate target capable of mediating the beneficial metabolic effects of metformin. AMPK is a multisubunit enzyme that is recognized as a major regulator of lipid biosynthetic pathways due to its role in the phosphorylation and inactivation of key enzymes such as acetyl-CoA carboxylase (ACC) (10). More recent data strongly suggest that AMPK has a wider role in metabolic regulation (10, 11): this includes fatty acid oxidation, muscle glucose uptake (12–14), expression of cAMP-stimulated gluconeogenic genes such as PEPCK and G6Pase (15), and glucose-stimulated genes associated with hepatic lipogenesis, including fatty acid synthase (FAS), Spot-14 (S14), and L-type pyruvate kinase (16). Chronic activation of AMPK may also induce the expression of muscle hexokinase and glucose transporters (Glut4), mimicking the effects of extensive exercise training (17). Thus, it has been predicted that AMPK activation would be a good approach to treat DM2 (11). In this report we tested the hypothesis that activation of AMPK mediates the beneficial metabolic effects of metformin.

Methods

Measurements of AMPK, ACC, and fatty acid oxidation in primary hepatocytes. Hepatocytes were isolated from male Sprague Dawley (SD) rats by collagenase digestion (18). For the AMPK assay, cells were seeded in six-well plates at 1.5 × 106 cells/well in DMEM containing 100 U/ml penicillin, 100 μg/ml streptomycin, 10% FBS, 100 nM insulin, 100 nM dexamethasone, and 5 μg/ml transferrin for 4 hours. Cells were then cultured in serum-free DMEM for 16 hours followed by treatment for 1 hour or 7 hours with control medium, 5-amino-imidazole carboxamide riboside (AICAR), or metformin at concentrations indicated. For a 39-hour treatment, cells for both control and metformin (10 or 20 μM) groups were cultured in DMEM plus 5% FBS and 100 nM insulin, and the fresh control and metformin-containing medium were replaced every 12 hours (last medium change was 3 hours before harvest). After treatment, the cells were directly lysed in digitonin-containing and phosphatase inhibitor–containing buffer A (19), followed by precipitation with ammonium sulfate at 35% saturation. AMPK activity was determined by measurement of phosphorylation of a synthetic peptide substrate, SAMS (HMRSAMSGLHLVKRR) (20). For ACC assay, the 35% ammonium sulfate precipitate from digitonin-lysed hepatocytes (4 μg each) was used for determination of ACC activity via 14CO2 fixation in the presence of 20 mM citrate as done previously (19). For fatty acid oxidation, the oxidation of 14C-oleate to acid-soluble products was performed as done previously (21), but in medium M199 in the absence of albumin.

AMPK partial purification and in vitro kinase assay. Liver AMPK was partially purified from male SD rats (22) to the blue-Sepharose step. The 100-μl reaction mixture contained 100 μM AMP, 100 μM ATP (0.5 μCi 33P-ATP per reaction), and 50 μM SAMS in a buffer (40 mM HEPES, pH 7.0, 80 mM NaCl, 0.8 mM EDTA, 5 mM MgCl2, 0.025% BSA, and 0.8 mM DTT). The reaction was initiated with addition of the enzyme. After 30-minute incubation at 30°C, the reaction was stopped by addition of 80 μl 1% H3PO4. Aliquots (100 μl) were transferred to 96-well MultiScreen plates (MAPHNOB50; Millipore Corp., Bedford, Massachusetts, USA). The plate was washed three times with 1% H3PO4 followed by detection in a Top-count. The in vitro AMPK inhibition data obtained with compound C — (6-[4-(2-Piperidin-1-yl-ethoxy)-phenyl)]-3-pyridin-4-yl-pyyrazolo[1,5-a] pyrimidine — were fit to the following equation for competitive inhibition by nonlinear regression using a least-squares Marquardt algorithm in a computer program written by N. Thornberry of Merck Research Laboratories: Vi/Vo = (Km + S)/[S + Km × (1 + I/Ki)], where Vi is the inhibited velocity, Vo is the initial velocity, S is the substrate (ATP) concentration, Km is the Michaelis constant for ATP, I is the inhibitor (compound C) concentration, and Ki is the dissociation constant for compound C.

Quantitation of mRNA. Rat hepatocytes were seeded and starved in M199 medium as described (16). Cells were then treated for 6 hours with the same serum-free and hormone-containing medium containing 25 mM glucose in the presence or absence of AICAR or increasing concentrations of metformin as indicated. Total RNAs were extracted from cultured hepatocytes using the guanidine thiocyanate method (TRIZOL; Life Technologies Inc., Gaithersburg, Maryland, USA). The mRNA was quantitated using a TaqMan One Step Gold RT-PCR kit (Applied Biosystems, Branchburg, New Jersey, USA). Primers were as follows: for S14, S14p (6FAM-TGGTGATGATCCCCAGCCTTCTGAG), S14F (TGTGGTGCGGAACATGGA), and S14R (CTCCGGACCCACTCAGCTC); for FAS, FASp (6FAM-TCCGCC AGAGCCCTTTGTTAA-TTGG), FASF (AACTGAACGGCATTACT-CGGTC), and FASR (GTGTCCCATGTTGGATTTGGT); for sterol regulatory element-binding protein 1 (SREBP1), SREBP1p (6FAM-TCCACCATCGGCACCCACTGCT), SREBP1F (AGGACCCAAGGTGACACCTG), SREBP1R (GCCGGACGGG-TACATCTTT).

Hepatocyte glucose production. Hepatocytes from 24-hour starved rats were incubated at 2 × 106 cell/ml in bicarbonate-buffered saline medium containing 10 mM L-lactate, 1 mM pyruvate, 0.3 μM glucagon, with a gas phase of O2/CO2 (19:1). Glucose was measured using glucose oxidase kit from Sigma Chemical Co. (St. Louis, Missouri, USA).

Measurements of muscle AMPK activity and glucose uptake. Isolated rat epitrochlearis muscles were incubated for 3 hours with metformin (2 mM) or control medium followed by measurement of AMPKα1 or AMPKα2 activities as described (23). For glucose uptake, insulin (300 nM) was present where indicated for the last 30 minutes of the 3-hour incubation. Then, 3-0-methylglucose uptake was measured using a 10-minute incubation in the absence or presence of metformin and/or insulin as described previously (23).

Animal experiments. Oral gavage was used to administer 1 ml of metformin (100 mg/ml) or water alone to male SD rats (300–350 g, n = 7–8). Rats were treated once (see Table 1and Figure 5b) or twice (see Figure 6) a day for 5 days. Rats were starved for 20 hours and then re-fed for 2 hours before the final dose; 4 hours after final dose, the animals were anesthetized and livers rapidly removed by freeze clamping followed by blood withdrawal. RNA was prepared from the freeze-clamped liver by Ultraspec RNA isolation reagent (Biotecx Laboratories Inc., Houston, Texas, USA). Nuclear extracts were prepared from a pool of seven rat livers (24). Glucose levels were determined using the standard glucose oxidase assay kit; β-hydroxybutyrate concentrations were assayed by measuring the reduction of NAD to NADH with a standard assay kit (Sigma Chemical Co.). FFA levels were measured with the assay kit from Boehringer Mannheim GmbH (Mannheim, Germany). Triglyceride levels were assayed with a kit from Roche Diagnostics (Indianapolis, Indiana, USA). Insulin concentrations were measured with the enzyme-immunoassay kit from ALPCO Ltd. (Windham, New Hampshire, USA). All in vivo experiments were approved by the Institutional Animal Care and Use Committee.

Metformin and AICAR downregulate hepatic SREBP-1. (a) Metformin (500 μM) anFigure 5

Metformin and AICAR downregulate hepatic SREBP-1. (a) Metformin (500 μM) and AICAR (500 μM) have similar effects to suppress SREBP-1 mRNA expression in rat hepatocytes. Mean ± SEM (n = 3 replicate assays) are shown. Insulin significantly increased SREBP-1 mRNA (P = 0.03 vs. control medium by Student’s t test). Both AICAR and metformin significantly decreased SREBP-1 mRNA with P values of 0.0046 and 0.01, respectively, versus insulin. (b) Metformin prevents re-fed stimulated accumulation of mature SREBP-1 in nuclear extracts from treated rats. Western blot analysis using a monoclonal anti–SREBP-1 Ab (prepared from hybridoma CRL-2121) was performed. Similar results were obtained from a separate in vivo experiment.

Metformin inhibits hepatic ACC activity in vivo. ACC activity was analyzedFigure 6

Metformin inhibits hepatic ACC activity in vivo. ACC activity was analyzed in the presence or absence of the indicated citrate concentrations using liver samples from fed rats treated for 5 days with control vehicle (filled squares, n = 7) or treated with 200 mg/kg (twice daily oral gavage) metformin (open squares,n = 8). **P < 0.01.

Table 1

In vivo effects of metformin on selected parameters known to be downstream of AMPK activation

Immunoblot analysis. For phospho-AMPK (Thr172) detection, the 35% ammonium sulfate precipitate from treated rat hepatocytes was used for Western blot analysis using polyclonal Ab’s to phospho AMPKα (Thr172; Cell Signaling Technology, Beverly, Massachusetts, USA). For SREBP-1, 100 μg nuclear extracts from metformin-treated rat livers were similarly analyzed, but using monoclonal anti–SREBP-1 Ab (prepared from hybridoma CRL-2121; American Type Culture Collection [ATCC], Rockville, Maryland, USA).

Immunoprecipitation-AMPK assay. Ten micrograms of 35% ammonium sulfate precipitate (containing AMPK) from AICAR- or metformin-treated rat hepatocytes was immunoprecipitated using polyclonal Ab’s raised against AMPKα1 (NH2-DFYLATSPPDSFLDDHHLTR-OH) or AMPKα2 (NH2-MDDSAMHIPPGLKPH-OH), followed by AMPK assay.

Results

Metformin promotes AMPK activation in primary rat hepatocytes. Although steady-state plasma levels of metformin in humans are reported to be around 10 μM (25, 26) to as high as 40 μM (27), studies in rats showed that levels in liver are severalfold higher than in plasma (28). Thus, liver levels of greater than 180 μM can be achieved in rats after a 50 mg/kg dose (29); this dose is lower than doses typically required for efficacy in diabetic rats (30, 31). In addition to the fact that high concentrations may be achieved in target tissues, membrane permeability of metformin is a time-dependent and slow process (32). Therefore, we anticipated that high concentrations and/or longer-term experiments might be required in order to see effects of metformin on AMPK in cells or tissues. In primary cultured hepatocytes from both rats and humans, metformin activated AMPK in a concentration- and time-dependent manner (Figure 1a and data not shown). AICAR was used as positive control. AICAR is a cell-permeable adenosine analogue that can be phosphorylated to ZMP, an AMP analogue and known AMPK activator (10). After a 1-hour treatment, 500 μM metformin was required to significantly activate AMPK, whereas after a 7-hour treatment, 50 μM was sufficient to significantly activate the enzyme. Maximal AMPK stimulation, comparable to the effect of 500 μM AICAR, was achieved with metformin concentrations of 2,000 μM (1 hour) or 500 μM (7 hours). To ensure that lower concentrations could mediate a similar effect, rat hepatocytes were incubated with 10 μM or 20 μM metformin for 39 hours. Both 10 μM and 20 μM metformin produced significant AMPK activation (1.3-fold, P = 0.0062, and 1.6 fold, P = 0.0007, respectively; Figure 1a). Given the time-dependent effects of metformin, we relied on relatively high concentrations in several shorter-term experiments described below in order to augment the ability to see relevant effects. In Figure 1b, we used an immunoprecipitation-AMPK assay to show that metformin as well as AICAR activated AMPK in both AMPKα1 and AMPKα2 complexes efficiently.

Metformin mediates AMPK activation in primary hepatocytes. (a) Metformin (bFigure 1

Metformin mediates AMPK activation in primary hepatocytes. (a) Metformin (black bars) and AICAR (A; 500 μM) activate AMPK in rat primary hepatocytes. The treatments were 1 hour, 7 hours, and 39 hours, respectively. (b) Metformin (500 μM) and AICAR (500 μM) activated both AMPKα1 and AMPKα2 complexes demonstrated by immunoprecipitation-AMPK assay. DPM, disintegrations per minute. (c) Metformin (1 mM) and AICAR (500 μM) stimulated AMPK Thr172 phosphorylation. (d) Metformin does not activate partially purified rat liver AMPK in vitro. (e) Metformin and AICAR (500 μM) inactivate ACC in rat primary hepatocytes. (f) Metformin (500 μM, 4 hours) and AICAR (500 μM, 4 hours) stimulate hepatocyte fatty acid oxidation. C, vehicle control. Mean (n = 3 wells per treatment for 1 hour and 7 hours; for 39-hour treatment, n = 12–15 wells per treatment) ± SEM values are shown. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control medium (paired t test).

AMP activates AMPK by promoting its phosphorylation at Thr 172 and by direct activation via an allosteric AMP site. Since enzyme activity shown in Figure 1, a and b, was measured after precipitation from hepatocyte lysates and in the presence of AMP, it is likely that metformin promotes AMPK phosphorylation. In keeping with this notion, we observed that treatment of hepatocytes with either metformin or AICAR resulted in slower electrophoretic mobility of AMPKα1 and AMPKα2, which is consistent with increased Ser/Thr phosphorylation (data not shown). More specifically, both metformin and AICAR treatment induced AMPK Thr172 phosphorylation demonstrated by using anti–phospho-AMPK Ab (Figure 1c).

Recent observations suggest that metformin can impair oxidative phosphorylation by inhibiting mitochondrial phosphorylation complex 1 (32, 33). Although some have reported that very high metformin concentrations (10 mM) can suppress total cellular ATP levels (25, 33), Owen et al. (32) pointed out that more subtle changes in the free ATP/ADP ratio might occur with concentrations of metformin that do not suppress total ATP, but do inhibit gluconeogenesis. We also found that measured total ATP concentrations from metformin-treated (500–2,000 μM) rat hepatocytes were not affected (data not shown). Thus, it is still plausible that metformin could produce a subtle decline in the free ATP/ADP and ATP/AMP ratios or a change in local concentrations of nucleotides, serving as a stimulus for AMPK phosphorylation and activation. Alternatively, metformin could directly activate AMPK kinase (AMPKK) or promote AMPK phosphorylation by binding to AMPK and making it a better substrate for AMPKK or worse substrate for phosphatase PP2C (10). The possibility that metformin could be a direct allosteric AMPK activator was excluded by showing that, when incubated with partially purified rat liver AMPK, metformin (from 4 μM to 12 mM), unlike AMP, did not activate the enzyme (Figure 1d).

Metformin induces ACC inactivation in primary hepatocytes. As a result of AMPK activation, hepatocyte ACC activity was markedly suppressed by metformin treatment, paralleling concentrations and time points associated with AMPK activation (Figure 1e). ACC catalyzes the biosynthesis of malonyl-CoA from acetyl-CoA. Malonyl-CoA is an initial substrate for de novo fatty acid biosynthesis, and it serves as a potent inhibitor of carnitine palmitoyl transferase I (CPT-I), a rate-limiting step for fatty acid oxidation (34). Thus, decreased malonyl-CoA concentrations, as a result of ACC inactivation, could lead to decreased lipid synthesis and an increased rate of fatty acid oxidation. Indeed, like AICAR, metformin stimulated fatty acid oxidation in isolated rat hepatocytes (Figure 1f).

Metformin and AICAR suppress lipogenic gene expression. AMPK is also involved in gene regulation (10). As noted above, activation of AMPK can suppress the expression of several glucose-activated lipogenesis-associated genes. Similar to the effect of AICAR, progressive inhibition of glucose-induced FAS and S14 expression was measured in hepatocytes in response to increasing concentrations of metformin (Figure 2). As a control, expression of HMG-CoA reductase (HMGR), a gene not affected by AICAR, was not affected by metformin.

Treatment of hepatocytes with metformin or AICAR suppresses lipogenic genesFigure 2

Treatment of hepatocytes with metformin or AICAR suppresses lipogenic genes in rat primary hepatocytes. Taqman-based real-time RT-PCR was used to quantitate mRNAs for FAS, S14, and HMGR. Mean (n = 3 per treatment) ± SEM values are shown. *P < 0.05, **P < 0.01 vs. control medium (paired t test). C, control; A, positive control (AICAR, 500 μM). These experiments were repeated a minimum of three times with similar results.

Identification and characterization of AMPK inhibitor. To firmly establish the role of AMPK in mediating metformin’s effects, a high-throughput in vitro assay was used to identify small-molecule AMPK inhibitors. Screening of a compound library containing more than 10,000 molecules lead to the discovery and characterization of compound C (inset in Figure 3a). Experiments conducted using variable ATP concentrations revealed that compound C is a potent reversible inhibitor that is competitive with ATP, with Ki = 109 ± 16 nM in the absence of AMP (Figure 3a). In in vitro assays, compound C did not exhibit significant inhibition of several structurally related kinases including ZAPK, SYK, PKCθ, PKA, and JAK3. Thus, to our knowledge, this is the first description of a potent and selective small-molecule AMPK inhibitor that may be useful as a means to further assess the physiologic effects of this pathway. Incubation of cultured hepatocytes with compound C inhibited ACC inactivation by either AICAR or metformin (Figure 3b). Compound C also attenuated AICAR and metformin’s effect to increase fatty acid oxidation or suppress lipogenic genes in hepatocytes (not shown).

Discovery and use of a novel small-molecule AMPK inhibitor to establish thaFigure 3

Discovery and use of a novel small-molecule AMPK inhibitor to establish that the effects of metformin on ACC and glucose production are AMPK dependent. (a) Inhibition of partially purified AMPK by compound C (inset shows the chemical structure) is reversible and competitive with respect to ATP. The in vitro kinase assay was performed in the presence of 5 μM ATP, 0 μM AMP (filled circles), 100 μM ATP, 0 μM AMP (filled squares), and 100 μM ATP plus 100 μM AMP (open circles). (b) Compound C inhibits the effects of AICAR and metformin on ACC in rat hepatocytes. Mean (n = 3 per treatment) ± SEM values are shown. *P < 0.05 vs. control medium (paired t test). (c) Compound C attenuates the ability of metformin to suppress glucagon-stimulated glucose production by hepatocytes from 24-hour starved rats. At time 0, compound C (40 μM) was added, and at time 30 minutes, metformin (2 mM) was added. Squares, control; diamonds, metformin; circles, metformin plus compound C. Each point represents the mean ± SEM of four replicate assays. *P < 0.05, **P < 0.01 vs. metformin alone at the same time point (paired t test). The experiment was repeated three times with similar results.

Metformin-mediated hepatocyte glucose production requires AMPK activation. It is believed that metformin-mediated inhibition of hepatic glucose production (HGP) plays a major role in its glucose-lowering efficacy (2, 3, 6). Here, we determined that both metformin and AICAR were able to inhibit cumulative glucose production in primary cultured rat hepatocytes stimulated with glucagon (Figure 3c and data not shown). Importantly, coincubation of hepatocytes with compound C was able to attenuate the effects of metformin to decrease glucose production in these cells (Figure 3c), demonstrating that AMPK activation was required for metformin’s inhibitory effect on hepatocyte glucose production.

Metformin activates muscle AMPK and promotes glucose uptake. Since AMPK activation is implicated as a mechanism for stimulation of glucose uptake in skeletal muscle (12–14), we assessed the effect of metformin on glucose uptake and AMPK activity in intact rat epitrochlearis muscles. Incubation of isolated muscles with metformin resulted in an increase in the activity of both catalytic subunits of AMPK (Figure 4a). This was coincident with a significant increase in glucose uptake that was also observed to be additive with the effect of insulin stimulation (Figure 4b). In previous studies, AMPKα2 was stimulated to a greater extent than AMPKα1 by AICAR and other stress (23). Further studies will be required to assess this difference.

Metformin (Met; 2 mM, 3 hours) stimulates AMPK activity in skeletal muscleFigure 4

Metformin (Met; 2 mM, 3 hours) stimulates AMPK activity in skeletal muscle in association with induction of glucose uptake. (a) AMPK activity; (b) glucose uptake. Mean (n = 5–6 isolated rat epitrochlearis muscles per treatment) ± SEM values is shown.

AMPK activation suppresses SREBP-1. SREBP-1c is an important insulin-stimulated transcription factor that is implicated in the pathogenesis of insulin resistance, dyslipidemia, and DM2 (35, 36). Target genes that are induced by SREBP-1 include those that encode lipogenic enzymes, such as FAS and S14. Under conditions where SREBP-1 was induced by insulin, incubation of rat hepatocytes with metformin or AICAR strongly suppressed SREBP-1 mRNA expression (Figure 5a). Thus, a new pathway by which AMPK can mediate effects on lipogenic gene expression was also identified via these experiments.

Assessment of metformin’s in vivo effects. To assess whether selected effects of metformin described above also occurred in vivo, SD rats were studied (Table 1). Rats were orally dosed with metformin or vehicle (H2O) for 5 days. Rats were starved for 20 hours and then re-fed for 2 hours before the final dose. Four hours after the final dose, tissue and blood samples were obtained for analysis (see Methods). During starvation, there should be very little lipid synthesis. Upon refeeding, hepatic lipid synthesis should be dramatically induced. Metformin’s effects were examined under re-fed conditions. Along with modest decreases in plasma insulin and triglycerides, a small, but significant increase in β-hydroxybutyrate was present, suggesting that hepatic fatty acid oxidation was induced in metformin-treated rats. Furthermore, metformin treatment produced significant decreases in hepatic expression of mRNAs for SREBP-1, FAS, and S14 that were consistent with effects documented in cells (Table 1).

The mature SREBP-1 protein in rat liver nuclear extracts was examined using an anti-SREBP1 Ab (Figure 5b). As anticipated (35), SREBP-1 mature-form protein was not detected in hepatic nuclear extracts from starved animals. In re-fed animals, mature SREBP-1 protein had accumulated consistent with an increase in lipid synthesis under this condition. Treatment with metformin prevented this accumulation. Additional results obtained using hepatic nuclear extracts from re-fed rats after treatment with AICAR (500 mg/kg/day) also showed that the presence of SREBP-1 mature-form protein was ablated (data not shown).

Measurement of AMPK activation in liver ex vivo is difficult because brief hypoxia is known to produce marked activation of the enzyme (ref. 37 and data not shown). Thus we used liver tissue derived from metformin-treated rats to determine that ACC activity was decreased significantly at several tested citrate concentrations (Figure 6). The greatest ACC activity reduction was at a citrate concentration of 1 mM (from 54.6 ± 11.8 to 35.6 ± 7.7 nmol/mg/min; P < 0.01). These results are consistent with metformin having produced in vivo AMPK activation and ACC inactivation.

Discussion

To summarize, results presented here are consistent with a model (Figure 7) in which increased phosphorylation and activation of AMPK by metformin leads to the effects on glucose and lipid metabolism as follows. Phosphorylation and inactivation of ACC, as a result of AMPK activation, serves to inhibit the proximal and rate-limiting step of lipogenesis. Reduced synthesis of the ACC product, malonyl-CoA, is also predicted to relieve inhibition of CPT-1, resulting in increased fatty acid oxidation. These effects are likely to contribute to metformin’s in vivo ability to lower triglycerides and VLDL.

Model for the mechanism by which metformin mediates effects on lipid and glFigure 7

Model for the mechanism by which metformin mediates effects on lipid and glucose metabolism. FA, fatty acid.

AMPK mediates a decrease in SREBP-1 mRNA and protein expression. Known target genes for SREBP-1, which include FAS and S14, are also downregulated in liver, further contributing to metformin’s effects to modulate circulating lipids and to reduce hepatic lipid synthesis and fatty liver. It should be noted that increased SREBP-1 is postulated as a central mediator of insulin resistance in DM2 and related metabolic disorders (35, 36) and that increased liver lipid content is implicated in hepatic insulin resistance (38).

Metformin-mediated effects on hepatic glucose production contribute to its glucose-lowering efficacy. We demonstrated (using an AMPK inhibitor, Figure 3) that AMPK activation is required for inhibition of hepatocyte glucose production by metformin under the test conditions we employed. Additional studies will be required to further elucidate precise mechanism(s) by which metformin-stimulated AMPK activation could result in inhibition of hepatic glucose production.

AMPK activation is implicated as a mechanism for the induction of skeletal muscle glucose uptake; this effect is also additive with insulin (12). Thus, the observed association of increased glucose uptake and AMPK activation in isolated skeletal muscles suggests that metformin’s effect to augment muscle insulin action in vivo may be attributed to AMPK as well.

A major mechanism (AMPK activation) by which metformin produces beneficial metabolic effects has been characterized, along with discovery of the mechanism (SREBP-1 suppression), by which AMPK inhibits the expression of lipogenic genes. Attempts to generate novel therapies for metabolic disease via AMPK activation may be worthy of pursuit.

Acknowledgments

We thank Shiying Chen for characterizing anti-AMPK Ab’s, Marcie Donnelly for technical support related to animal studies, Mark Fraley for compound synthesis, and Georgianna Harris and Denis McGarry for helpful discussions and intellectual support.

Footnotes

See the related Commentary beginning on page 1105.

References
  1. 2000. IMS HEALTH’s National Prescription Audit PlusTM. http://www.ims-global.com.
    View this article via: PubMed Google Scholar
  2. Stumvoll, M, Nurjhan, N, Perriello, G, Dailey, G, Gerich, JE. Metabolic effects of metformin in non-insulin-dependent diabetes mellitus. N Engl J Med 1995. 333:550-554.
    View this article via: PubMed CrossRef Google Scholar
  3. Wiernsperger, NF, Bailey, CJ. The antihyperglycaemic effect of metformin: therapeutic and cellular mechanisms. Drugs 1999. 58:31-39.
    View this article via: PubMed Google Scholar
  4. Wu, MS, et al. Effect of metformin on carbohydrate and lipoprotein metabolism in NIDDM patients. Diabetes Care 1990. 13:1-8.
    View this article via: PubMed CrossRef Google Scholar
  5. Schafer, G. Biguanides. A review of history, pharmacodynamics and therapy. Diabete Metab 1983. 9:148-163.
    View this article via: PubMed Google Scholar
  6. Hundal, RS, et al. Mechanism by which metformin reduces glucose production in type 2 diabetes. Diabetes 2000. 49:2063-2069.
    View this article via: PubMed CrossRef Google Scholar
  7. Hundal, HS, Ramlal, T, Reyes, R, Leiter, LA, Klip, A. Cellular mechanism of metformin action involves glucose transporter translocation from an intracellular pool to the plasma membrane in L6 muscle cells. Endocrinology 1992. 131:1165-1173.
    View this article via: PubMed CrossRef Google Scholar
  8. Galuska, D, Nolte, LA, Zierath, JR, Wallberg-Henriksson, H. Effect of metformin on insulin-stimulated glucose transport in isolated skeletal muscle obtained from patients with NIDDM. Diabetologia 1994. 37:826-832.
    View this article via: PubMed CrossRef Google Scholar
  9. Lin, HZ, et al. Metformin reverses fatty liver disease in obese, leptin-deficient mice. Nat Med 2000. 6:998-1003.
    View this article via: PubMed CrossRef Google Scholar
  10. Hardie, DG, Carling, D. The AMP-activated protein kinase: fuel gauge of the mammalian cell? Eur J Biochem 1997. 246:259-273.
    View this article via: PubMed CrossRef Google Scholar
  11. Winder, WW, Hardie, DG. AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes. Am J Physiol 1999. 277:E1-E10.
    View this article via: PubMed Google Scholar
  12. Hayashi, T, Hirshman, MF, Kurth, EJ, Winder, WW, Goodyear, LJ. Evidence for 5′ AMP-activated protein kinase mediation of the effect of muscle contraction on glucose transport. Diabetes 1998. 47:1369-1373.
    View this article via: PubMed CrossRef Google Scholar
  13. Merrill, GF, Kurth, EJ, Hardie, DG, Winder, WW. AICA riboside increases AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle. Am J Physiol 1997. 273:E1107-E1112.
    View this article via: PubMed Google Scholar
  14. Goodyear, LJ. AMP-activated protein kinase: a critical signaling intermediary for exercise-stimulated glucose transport? Exerc Sport Sci Rev 2000. 28:113-116.
    View this article via: PubMed Google Scholar
  15. Lochhead, PA, Salt, IP, Walker, KS, Hardie, DG, Sutherland, C. 5-aminoimidazole-4-carboxamide riboside mimics the effects of insulin on the expression of the 2 key gluconeogenic genes PEPCK and glucose-6-phosphatase. Diabetes 2000. 49:896-903.
    View this article via: PubMed CrossRef Google Scholar
  16. Foretz, M, Carling, D, Guichard, C, Ferre, P, Foufelle, F. AMP-activated protein kinase inhibits the glucose-activated expression of fatty acid synthase gene in rat hepatocytes. J Biol Chem 1998. 273:14767-14771.
    View this article via: PubMed CrossRef Google Scholar
  17. Holmes, BF, Kurth-Kraczek, EJ, Winder, WW. Chronic activation of 5′-AMP-activated protein kinase increases GLUT-4, hexokinase, and glycogen in muscle. J Appl Physiol 1999. 87:1990-1995.
    View this article via: PubMed Google Scholar
  18. Pollard, J.W., and Walker, J.M., editors. 1992. Basic cell culture protocols. Methods in Molecular Biology series, Volume 75. Humana Press Inc. Totowa, New Jersey, USA. 145–150.
    View this article via: PubMed Google Scholar
  19. Witters, LA, Kemp, BE. Insulin activation of acetyl-CoA carboxylase accompanied by inhibition of the 5′-AMP-activated protein kinase. J Biol Chem 1992. 267:2864-2867.
    View this article via: PubMed Google Scholar
  20. Davies, SP, Carling, D, Hardie, DG. Tissue distribution of the AMP-activated protein kinase, and lack of activation by cyclic-AMP-dependent protein kinase, studied using a specific and sensitive peptide assay. Eur J Biochem 1989. 186:123-128.
    View this article via: PubMed CrossRef Google Scholar
  21. Mannaerts, GP, Debeer, LJ, Thomas, J, DeSchepper, PJ. Mitochondrial and peroxisomal fatty acid oxidation in liver homogenates and isolated hepatocytes from control and clofibrate-treated rats. J Biol Chem 1979. 254:4585-4595.
    View this article via: PubMed Google Scholar
  22. Carling, D, Clarke, PR, Zammit, VA, Hardie, DG. Purification and characterization of the AMP-activated protein kinase. Copurification of acetyl-CoA carboxylase kinase and 3-hydroxy-3-methylglutaryl-CoA reductase kinase activities. Eur J Biochem 1989. 186:129-136.
    View this article via: PubMed CrossRef Google Scholar
  23. Hayashi, T, et al. Metabolic stress and altered glucose transport: activation of AMP-activated protein kinase as a unifying coupling mechanism. Diabetes 2000. 49:527-531.
    View this article via: PubMed CrossRef Google Scholar
  24. Sheng, Z, Otani, H, Brown, MS, Goldstein, JL. Independent regulation of sterol regulatory element-binding proteins 1 and 2 in hamster liver. Proc Natl Acad Sci USA 1995. 92:935-938.
    View this article via: PubMed CrossRef Google Scholar
  25. Cusi, K, DeFronzo, RA. Metformin: a review of its metabolic effects. Diabetes Reviews 1998. 6:89-131.
  26. Wiernsperger, NF. Membrane physiology as a basis for the cellular effects of metformin in insulin resistance and diabetes. Diabetes Metab 1999. 25:110-127.
    View this article via: PubMed Google Scholar
  27. Sum, CF, et al. The effect of intravenous metformin on glucose metabolism during hyperglycaemia in type 2 diabetes. Diabet Med 1992. 9:61-65.
    View this article via: PubMed Google Scholar
  28. Wilcock, C, Wyre, ND, Bailey, CJ. Subcellular distribution of metformin in rat liver. J Pharm Pharmacol 1991. 43:442-444.
    View this article via: PubMed Google Scholar
  29. Wilcock, C, Bailey, CJ. Accumulation of metformin by tissues of the normal and diabetic mouse. Xenobiotica 1994. 24:49-57.
    View this article via: PubMed Google Scholar
  30. Hermann, LS. Metformin: a review of its pharmacological properties and therapeutic use. Diabete Metab 1979. 5:233-245.
    View this article via: PubMed Google Scholar
  31. Sterne, J, Duval, D, Junien, JL. Metformin therapy. Research Clinical Forums 1979. 1:13.
  32. Owen, MR, Doran, E, Halestrap, AP. Evidence that metformin exerts its anti-diabetic effects through inhibition of complex 1 of the mitochondrial respiratory chain. Biochem J 2000. 348:607-614.
    View this article via: PubMed CrossRef Google Scholar
  33. El-Mir, MY, et al. Dimethylbiguanide inhibits cell respiration via an indirect effect targeted on the respiratory chain complex I. J Biol Chem 2000. 275:223-228.
    View this article via: PubMed CrossRef Google Scholar
  34. McGarry, JD, Brown, NF. The mitochondrial carnitine palmitoyltransferase system. From concept to molecular analysis. Eur J Biochem 1997. 244:1-14.
    View this article via: PubMed CrossRef Google Scholar
  35. Shimomura, I, et al. Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol Cell 2000. 6:77-86.
    View this article via: PubMed CrossRef Google Scholar
  36. Kakuma, T, et al. Leptin, troglitazone, and the expression of sterol regulatory element binding proteins in liver and pancreatic islets. Proc Natl Acad Sci USA 2000. 97:8536-8541.
    View this article via: PubMed CrossRef Google Scholar
  37. Davies, SP, Carling, D, Munday, MR, Hardie, DG. Diurnal rhythm of phosphorylation of rat liver acetyl-CoA carboxylase by the AMP-activated protein kinase, demonstrated using freeze-clamping. Effects of high fat diets. Eur J Biochem 1992. 203:615-623.
    View this article via: PubMed CrossRef Google Scholar
  38. McGarry, JD. What if Minkowski had been ageusic? An alternative angle on diabetes. Science 1992. 258:766-770.
    View this article via: PubMed CrossRef Google Scholar
Version history
  • Version 1 (October 15, 2001): No description

Article tools

  • View PDF
  • Download citation information
  • Send a comment
  • Share this article
  • Terms of use
  • Standard abbreviations
  • Need help? Email the journal

Related comments

  • Metformin's primary site of action is the respiratory chain
    Andrew P Halestrap

Metrics

  • Article usage
  • Citations to this article

Go to

  • Top
  • Abstract
  • Introduction
  • Methods
  • Results
  • Discussion
  • Acknowledgments
  • Footnotes
  • References
  • Version history
Advertisement
Advertisement

Copyright © 2023 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)

Sign up for email alerts