Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno-neuroendocrine interfacing
Corinne Bousquet, … , Maria Chiara Zatelli, Shlomo Melmed
Corinne Bousquet, … , Maria Chiara Zatelli, Shlomo Melmed
Published December 1, 2000
Citation Information: J Clin Invest. 2000;106(11):1417-1425. https://doi.org/10.1172/JCI11182.
View: Text | PDF
Article

Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno-neuroendocrine interfacing

Abstract

Neuroendocrine ACTH secretion responds to peripheral inflammatory and stress signals. We previously demonstrated that the proinflammatory cytokine, leukemia inhibitory factor (LIF), affects the hypothalamo-pituitary-adrenal axis (HPA) by stimulating in vitro and in vivo pituitary proopiomelanocortin (POMC) gene expression and ACTH secretion and by potentiating the action of hypothalamic corticotropin releasing hormone (CRH). Whereas pathways shown thus far to regulate POMC expression exclusively involve cAMP or calcium, we here describe a direct and indirect STAT3-dependent regulation of POMC transcription by LIF. Using progressive 5′-deletions of POMC promoter, we identified a LIF-responsive –407/–301 region that contains two juxtaposed sequences within –399/–379 related to a STAT3 DNA-binding motif. Each sequence within –399/–379 separately corresponds to a low-affinity and direct binding site for STAT3, but, in combination, these sequences bind STAT3 cooperatively and with high affinity. Moreover, LIF-activated STAT3 indirectly mediates LIF corticotroph action by inducing and potentiating CRH-induced c-fos and JunB expression and binding to the POMC AP-1 element. We therefore conclude that both a direct and indirect route mediate LIF-induced STAT3 activation of POMC transcription. Demonstration of STAT3-dependent regulation of the POMC gene represents a powerful mechanism for immuno-neuroendocrine interfacing and implies a direct stimulation of ACTH secretion by inflammatory and stress-derived STAT3-inducing cytokines.

Authors

Corinne Bousquet, Maria Chiara Zatelli, Shlomo Melmed

×

Figure 3

Options: View larger image (or click on image) Download as PowerPoint
Characterization of two cooperative low-affinity STAT3 binding sites on ...
Characterization of two cooperative low-affinity STAT3 binding sites on the POMC promoter. (a) This experiment was performed as in Figure 2a, except that competition was performed with 100-fold molar excess of cold mut1 (5′- –407 TAGTGATAGTGACATCCAGATGCCAGGAAGGCAG–374 -3′), mut2 (5′- –407TAGTGATATTTACCTCCAAAGGCTAGTGAGGCAG–374 -3′), mut1-2 (5′- –407TAGTGATAGTGACATCCAGAGGCTAGTGAGGCAG–374 -3′), or nonspecific POMC exon-1 AP-1 oligonucleotide. (b and c) Competition was performed as in a with 25-fold, 50-fold, or 75-fold molar excess of wild-type –407/–374 (self) or mut1 or mut2 cold double-stranded oligonucleotide. NT, vehicle-treated control.