Go to JCI Insight
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
  • Clinical Research and Public Health
  • Current issue
  • Past issues
  • By specialty
    • COVID-19
    • Cardiology
    • Gastroenterology
    • Immunology
    • Metabolism
    • Nephrology
    • Neuroscience
    • Oncology
    • Pulmonology
    • Vascular biology
    • All ...
  • Videos
    • Conversations with Giants in Medicine
    • Video Abstracts
  • Reviews
    • View all reviews ...
    • Pancreatic Cancer (Jul 2025)
    • Complement Biology and Therapeutics (May 2025)
    • Evolving insights into MASLD and MASH pathogenesis and treatment (Apr 2025)
    • Microbiome in Health and Disease (Feb 2025)
    • Substance Use Disorders (Oct 2024)
    • Clonal Hematopoiesis (Oct 2024)
    • Sex Differences in Medicine (Sep 2024)
    • View all review series ...
  • Viewpoint
  • Collections
    • In-Press Preview
    • Clinical Research and Public Health
    • Research Letters
    • Letters to the Editor
    • Editorials
    • Commentaries
    • Editor's notes
    • Reviews
    • Viewpoints
    • 100th anniversary
    • Top read articles

  • Current issue
  • Past issues
  • Specialties
  • Reviews
  • Review series
  • Conversations with Giants in Medicine
  • Video Abstracts
  • In-Press Preview
  • Clinical Research and Public Health
  • Research Letters
  • Letters to the Editor
  • Editorials
  • Commentaries
  • Editor's notes
  • Reviews
  • Viewpoints
  • 100th anniversary
  • Top read articles
  • About
  • Editors
  • Consulting Editors
  • For authors
  • Publication ethics
  • Publication alerts by email
  • Advertising
  • Job board
  • Contact
Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno-neuroendocrine interfacing
Corinne Bousquet, … , Maria Chiara Zatelli, Shlomo Melmed
Corinne Bousquet, … , Maria Chiara Zatelli, Shlomo Melmed
Published December 1, 2000
Citation Information: J Clin Invest. 2000;106(11):1417-1425. https://doi.org/10.1172/JCI11182.
View: Text | PDF
Article

Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno-neuroendocrine interfacing

  • Text
  • PDF
Abstract

Neuroendocrine ACTH secretion responds to peripheral inflammatory and stress signals. We previously demonstrated that the proinflammatory cytokine, leukemia inhibitory factor (LIF), affects the hypothalamo-pituitary-adrenal axis (HPA) by stimulating in vitro and in vivo pituitary proopiomelanocortin (POMC) gene expression and ACTH secretion and by potentiating the action of hypothalamic corticotropin releasing hormone (CRH). Whereas pathways shown thus far to regulate POMC expression exclusively involve cAMP or calcium, we here describe a direct and indirect STAT3-dependent regulation of POMC transcription by LIF. Using progressive 5′-deletions of POMC promoter, we identified a LIF-responsive –407/–301 region that contains two juxtaposed sequences within –399/–379 related to a STAT3 DNA-binding motif. Each sequence within –399/–379 separately corresponds to a low-affinity and direct binding site for STAT3, but, in combination, these sequences bind STAT3 cooperatively and with high affinity. Moreover, LIF-activated STAT3 indirectly mediates LIF corticotroph action by inducing and potentiating CRH-induced c-fos and JunB expression and binding to the POMC AP-1 element. We therefore conclude that both a direct and indirect route mediate LIF-induced STAT3 activation of POMC transcription. Demonstration of STAT3-dependent regulation of the POMC gene represents a powerful mechanism for immuno-neuroendocrine interfacing and implies a direct stimulation of ACTH secretion by inflammatory and stress-derived STAT3-inducing cytokines.

Authors

Corinne Bousquet, Maria Chiara Zatelli, Shlomo Melmed

×

Figure 2

Options: View larger image (or click on image) Download as PowerPoint
Characterization of a STAT3 binding site on the POMC promoter. (a and b)...
Characterization of a STAT3 binding site on the POMC promoter. (a and b) A 32P-labeled double-stranded oligonucleotide corresponding to region –407/–374 of the POMC promoter (5′- –407TAGTGATATTTACCTCCAAATGCCAGGAAGGCA G–374 -3′; in bold are the two STAT3 DNA-binding motifs) was used as probe. Cells were either untreated or treated with 1 nM LIF for 15 or 30 minutes. Using 15 μg nuclear extracts from 15-minute LIF-treated AtT20 cells, competition was performed with either 100-fold molar excess of (a) cold –407/–374 double-stranded oligonucleotide (self), of cold nonspecific POMC exon-1 AP-1 double-stranded oligonucleotide (AP-1) (5′- +33AGGAGCAGTGACTAAGAGAGGC+54 -3′; in bold is the consensus AP-1 motif), of (b) cold SIE oligonucleotide (5′- CGCGTCATTTCCCGTAAATCA -3′; in bold is the consensus SIE motif) (SIE), of cold mutated SIE oligonucleotide (5′- CGCGTCAGATCCCGTCATTCA -3′; the bold underlined italic letters correspond to the mutated bases from the SIE motif) (SIE mut), or with 1 μg anti-STAT3 (STAT3 Ab) or c-fos antibody (c-fos Ab). (c) POMC promoter deleted from –459/–355 (construct H) or mutated in the –399/–379 region (construct I) (5′- –399GTGACATCCAGAGGCTAGTG–379 -3′; the bold underlined italic letters correspond to the mutated bases from the POMCSTAT3 motifs) were fused to the luciferase reporter gene and transiently transfected in AtT20 cells (9). Cells were stimulated with 1 nM LIF or with 1 nM LIF + 10 nM CRH for 6 hours. Luciferase activity was measured in cell lysates in the presence of the luciferin substrate. Results are expressed as percentage of control (n ≥ 3; control = 100% = full-length –706/+64 POMC promoter). AP < 0.01 for deleted or mutated POMC promoter constructs (constructs H and I) versus full-length POMC promoter (black bar).

Copyright © 2025 American Society for Clinical Investigation
ISSN: 0021-9738 (print), 1558-8238 (online)

Sign up for email alerts