Fig. 1 Segregation of the human LEP mutation. a, A homozygous missense mutation at codon 105 of the LEP gene in patient 24. The coding region of exon 3 was amplified by PCR (sense primer, 5.–CAGTCAGTCTCCTCCAAACA–3, antisense primer, 5–CTTAACGTAGTCCTTGCAGG-3) b, PCR amplification restriction enzyme assay of the coding sequence of exon 3 (black boxes sequences). Positions of the primers are indicated by the arrows. Genomic lymphocyte DNA was isolated from blood (10 ml) using a lymphocyte DNA isolation kit (Boehringer). The restriction enzyme assay was performed with DNA of the PCR-amplified coding region of exon 3. An aliquot of the PCR mix was digested by Mspl (Gibco BRL) The mutation at codon 105 results in the disappearance of one of the two Mspl sites present in this sequence. Lanes 1 and 2, patient homozygous for the mutation; C lanes 3 and 4, individual heterozygous for the mutation; lanes 5 and 6, individual who does not carry the mutation;