A frameshift mutation in MC4R associated with dominantly inherited human obesity
GSH Yeo, IS Farooqi, S Aminian, DJ Halsall… - Nature …, 1998 - nature.com
Nature genetics, 1998•nature.com
Fig. 1 A frameshift mutation in MC4R is associated with dominantly inherited obesity. a, Half-
filled symbols indicate the heterozygote state of the two obese subjects in this pedigree. b,
MC4R is a 333-aa protein encoded by a single exon of 999 nt. Two primers, MC4Rforward
(5'–AATAACTGAGACGACTCCCTGAC–3') and MC4Rreverse (5'–
CAGAAGTACAATATTCAGGTAGGG–3'), were used in a PCR reaction to amplify the gene
from genomic DNA isolated from whole blood. The PCR was performed using BioTaq …
filled symbols indicate the heterozygote state of the two obese subjects in this pedigree. b,
MC4R is a 333-aa protein encoded by a single exon of 999 nt. Two primers, MC4Rforward
(5'–AATAACTGAGACGACTCCCTGAC–3') and MC4Rreverse (5'–
CAGAAGTACAATATTCAGGTAGGG–3'), were used in a PCR reaction to amplify the gene
from genomic DNA isolated from whole blood. The PCR was performed using BioTaq …
Fig. 1 A frameshift mutation in MC4R is associated with dominantly inherited obesity. a, Half-filled symbols indicate the heterozygote state of the two obese subjects in this pedigree. b, MC4R is a 333-aa protein encoded by a single exon of 999 nt. Two primers, MC4Rforward (5’–AATAACTGAGACGACTCCCTGAC–3’) and MC4Rreverse (5’–CAGAAGTACAATATTCAGGTAGGG–3’), were used in a PCR reaction to amplify the gene from genomic DNA isolated from whole blood. The PCR was performed using BioTaq (Bioline) and carried out under standard conditions, with 35 cycles of 95 oC for 30 s, 57 oC for 30 s and 72 oC for 50 s. Six nested primers, MC4F1 (5’–TGAGACGACTCCCTGACCCAG–3’), MC4F2 (5’–CATCACCCTATTAAACAGTACAG–3’), MC4F3 (5’–AGGCTTCACATTAAGAGGATTG–3’), MC4R1 (5’–TACAATATTCAGGTAGGGTAAGA–3’), MC4R2 (5’–TTGGCGGATGGCACCAGTGC–3’) and MC4R3 (5’–CACTGTGAAACTCTGTGCATC–3’) were then used, at an annealing temperature of 57 oC, to sequence the resulting PCR product on both strands. Sequencing was carried out using BigDye terminator chemistry (Perkin-Elmer) and electrophoresed on an ABI 377 automated DNA sequencer. The two subjects were heterozygous for a 4-nt ‘CTCT’deletion (highlighted with a box) at codon 211, resulting in a missing leucine and a frameshift that introduces a stop codon 5-aa downstream of the mutation. This disrupts the fifth transmembrane domain of the receptor and results in a truncated protein of 215 residues. The amino acid translation for the respective alleles is denoted in bold single letter code with the wild-type residues numbered in arabic numerals and the asterisk denotes a stop codon. The shaded bars in the schematic diagram of MC4R below represent each of the seven transmembrane domains and are denoted in roman numerals.
nature.com