Jci_page_head_homepage_01 Jci_page_head_homepage_02
Jeremy R. Graff, Bruce W. Konicek, Thomas M. Vincent, Rebecca L. Lynch, David Monteith, Spring N. Weir, Phil Schwier, Andrew Capen, Robin L. Goode, Michele S. Dowless, Yuefeng Chen, Hong Zhang, Sean Sissons, Karen Cox, Ann M. McNulty, Stephen H. Parsons, Tao Wang, Lillian Sams, Sandaruwan Geeganage, Larry E. Douglass, Blake Lee Neubauer, Nicholas M. Dean, Kerry Blanchard, Jianyong Shou, Louis F. Stancato, Julia H. Carter, Eric G. Marcusson
Published in Volume 117, Issue 9
J Clin Invest. 2007; 117(9):2638–2648 doi:10.1172/JCI32044
Abstract | Full text | PDF
Options: View larger image (or click on image)
Medium
Figure 2
eIF4E expression is reduced in cultured human and murine cells.

(A) eIF4E expression was assessed by quantitative RT-PCR. Representative data are shown for human cervical carcinoma cells (HeLa), human non–small cell lung cancer cells (A549), and murine endothelial cells (b.END cells) 24 hours after transfection. Cells were transfected using lipofectin, the eIF4E-specific ASOs, or the non-silencing ASO controls at the indicated concentrations (5′–3′, ASO ctrlA, GGATAGAACGCGAAAGCTTG; ASO ctrlB, GTACAGTTATGCGCGGTAGA; ASO ctrlC, CGTTATTAACCTCCGTTGAA; ASO ctrlD, TTAGAATACGTCGCGTTATG). Data are presented as the percentage of eIF4E in control untransfected cells. (BD) eIF4E protein expression was evaluated by Western blotting from cell lysates harvested 72 hours after transfection. Each blot was reprobed for β-actin to control for loading and transfer variations. Representative data are shown for human prostate cancer cell lines (CWR22Rv1 and PC-3), head and neck cancer cell lines (FaDu and SW579), a human breast cancer cell line (MDA-MB-231), a human non–small cell lung cancer cell line (NCI-H460), and the HUVEC. (B) Cells were transfected with 50, 100, or 200 nM 4E-ASO4 or the ASO control. (C) Data shown represent cells transfected with 200 nM 4E-ASO4 or the mismatch (MM) control. (D and E) MDA-MB-231 breast cancer cells were transfected with 4E-ASO4 or mismatch control ASO. Protein was harvested 72 hours after transfection, and lysates were analyzed by Western blotting for the indicated proteins.