Published in Volume 110, Issue 8 (October 15, 2002)
J Clin Invest. 2002;110(8):1211–1211. doi:10.1172/JCI15681C1.
Copyright © 2002, The American Society for Clinical Investigation.

Corrigendum

View original article

Cyclooxygenase-2 regulates mesenchymal cell differentiation into the osteoblast lineage and is critically involved in bone repair

Xinping Zhang, Edward M. Schwarz, Donald A. Young, J. Edward Puzas, Randy N. Rosier and Regis J. O’Keefe

Published October 15, 2002

Original citation: J. Clin. Invest. 109:1405–1415 (2002). doi:10.1172/JCI15681

Citation for this corrigendum: J. Clin. Invest. 109:1211 (2002). doi:10.1172/JCI15681C1

The authors would like to correct an error in the Methods section. The primer sequences used to amplify cbfa1 in the PCR reaction were TGGCAGCACGCTATTAAATC (forward) and TCTGCCGCTAGAATTCAAAA (reverse), instead of the primers listed in the published article.